Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23811
Trapped Gene
1700112C13Rik (ENSMUSG00000049719)
Vector Insertion
Chr 9: 110752309 - 110752499
Public Clones not available
Private Clones OST244168 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715741 (Chr9:110752042..110752308 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTGCAAGGTGGTAAATGG Chr9:110752166..110752185 59.85 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715741 (Chr9:110752042..110752308 +)
Downstram Exon
ENSMUSE00000391531 (Chr9:110752500..110752762 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTGCAAGGTGGTAAATGG Chr9:110752166..110752185 59.85 50 TGCGATTGATGAAGTTCTCG Chr9:110752618..110752637 59.95 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583134 Chr9:110747010..110747138 CAGTGGATCCTCACGGTCTT Chr9:110747067..110747086 60.11 55
upstream ENSMUSE00000715741 Chr9:110752042..110752308 ACCTGCAAGGTGGTAAATGG Chr9:110752166..110752185 59.85 50
upstream ENSMUSE00000348778 Chr9:110752131..110752308 GCAAGGTGGTAAATGGGAAG Chr9:110752170..110752189 59.43 50

*** Putative Vector Insertion (Chr 9: 110752309 - 110752499) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391531 Chr9:110752500..110752762 TGCGATTGATGAAGTTCTCG Chr9:110752618..110752637 59.95 45
downstream ENSMUSE00000220137 Chr9:110753819..110753982 GGAGGAACTGGTACCGATGA Chr9:110753908..110753927 59.93 55
downstream ENSMUSE00000406701 Chr9:110758504..110759026 CATCTGGACCCAGGTCTTGT Chr9:110758560..110758579 59.96 55
downstream ENSMUSE00000715516 Chr9:110758504..110759020 CATCTGGACCCAGGTCTTGT Chr9:110758560..110758579 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr9:110752359..110752379 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTACAAAGGTCAGCTCTGG Chr9:110752300..110752321 59.13 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049719