Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23816
Trapped Gene
Txndc11 (ENSMUSG00000022498)
Vector Insertion
Chr 16: 11128797 - 11134360
Public Clones not available
Private Clones OST243994 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000621930 (Chr16:11134361..11134666 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTTCGCCCTCAAGTTCAC Chr16:11134367..11134386 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000621930 (Chr16:11134361..11134666 -)
Downstram Exon
ENSMUSE00000383733 (Chr16:11128580..11128796 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTTCGCCCTCAAGTTCAC Chr16:11134367..11134386 59.99 55 AGAGGTCAAGGACCGGAGAT Chr16:11128698..11128717 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000621930 Chr16:11134361..11134666 CTCTTCGCCCTCAAGTTCAC Chr16:11134367..11134386 59.99 55
upstream ENSMUSE00000710980 Chr16:11134361..11134706 CTCTTCGCCCTCAAGTTCAC Chr16:11134367..11134386 59.99 55
upstream ENSMUSE00000718398 Chr16:11134361..11134704 CTCTTCGCCCTCAAGTTCAC Chr16:11134367..11134386 59.99 55

*** Putative Vector Insertion (Chr 16: 11128797 - 11134360) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383733 Chr16:11128580..11128796 AGAGGTCAAGGACCGGAGAT Chr16:11128698..11128717 60.07 55
downstream ENSMUSE00000265998 Chr16:11122763..11122860 CCTGGTTCCACCAACAGTTT Chr16:11122802..11122821 59.86 50
downstream ENSMUSE00000396034 Chr16:11116888..11117017 ATGGGGCCTTTGTATTCGAT Chr16:11116966..11116985 60.53 45
downstream ENSMUSE00000713595 Chr16:11114156..11117017 GAGGGTCTGAGGTCAGCTTG Chr16:11114445..11114464 59.99 60
downstream ENSMUSE00000704263 Chr16:11106341..11106364 No primer for this exon
downstream ENSMUSE00000389288 Chr16:11104659..11104752 TAACGAATGCAGTGCTGAGG Chr16:11104644..11104663 60.01 50
downstream ENSMUSE00000265976 Chr16:11093909..11094021 TGATAACCCCAAATCGCACT Chr16:11093967..11093986 60.33 45
downstream ENSMUSE00000374695 Chr16:11091679..11091879 AGGATGTCTCTCGGCTAGGG Chr16:11091669..11091688 60.75 60
downstream ENSMUSE00000398411 Chr16:11087870..11088662 AGCGGTACCTGTTCTCCTCA Chr16:11088073..11088092 59.87 55
downstream ENSMUSE00000722122 Chr16:11085612..11088662 TCTTCCAACTCCCTCCAATG Chr16:11085795..11085814 60.04 50
downstream ENSMUSE00000413715 Chr16:11084844..11084986 TCGTCACTTCCGTGATCAAA Chr16:11084857..11084876 60.24 45
downstream ENSMUSE00000127649 Chr16:11084301..11084410 GATTGAGAGACGGGCAAAAG Chr16:11084334..11084353 59.81 50
downstream ENSMUSE00000127647 Chr16:11079797..11079877 AAACGGTAGGAAGACGGTCA Chr16:11079794..11079813 59.59 50
downstream ENSMUSE00000621929 Chr16:11075014..11075735 AGAATGAACCGCAGCAGATT Chr16:11075645..11075664 59.84 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCTTCGCCCTCAAGTTCA Chr16:11134366..11134386 62.91 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCTTCGCCCTCAAGTTCAC Chr16:11131365..11131386 63.6 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022498