Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23823
Trapped Gene
Mvp (ENSMUSG00000030681)
Vector Insertion
Chr 7: 134142111 - 134144993
Public Clones not available
Private Clones OST243670 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000201918 (Chr7:134144994..134145189 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATAGTGGCCAACCCTGTGTC Chr7:134145118..134145137 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000201918 (Chr7:134144994..134145189 -)
Downstram Exon
ENSMUSE00000201929 (Chr7:134141987..134142110 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATAGTGGCCAACCCTGTGTC Chr7:134145118..134145137 59.85 55 GTCCAGCAATGCCTTCAGAT Chr7:134142026..134142045 60.23 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416335 Chr7:134158033..134158108 GTTGGTGAGGGAAATTCCTG Chr7:134158069..134158088 59.38 50
upstream ENSMUSE00000416328 Chr7:134145323..134145472 TGTGTCCCGTGTAGAGGTTG Chr7:134145357..134145376 59.59 55
upstream ENSMUSE00000201918 Chr7:134144994..134145189 ATAGTGGCCAACCCTGTGTC Chr7:134145118..134145137 59.85 55

*** Putative Vector Insertion (Chr 7: 134142111 - 134144993) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000201929 Chr7:134141987..134142110 GTCCAGCAATGCCTTCAGAT Chr7:134142026..134142045 60.23 50
downstream ENSMUSE00000201920 Chr7:134141740..134141871 GTTTGATGACTGTGGCCTGA Chr7:134141787..134141806 59.68 50
downstream ENSMUSE00000201925 Chr7:134139752..134139846 TGTAAGGATCACAGCGTCCA Chr7:134139736..134139755 60.26 50
downstream ENSMUSE00000201922 Chr7:134139250..134139486 CACCGTCACTAGCCATTCCT Chr7:134139378..134139397 60.13 55
downstream ENSMUSE00000201917 Chr7:134137034..134137315 AGGGATAGCCTGACGCTCTT Chr7:134137060..134137079 60.37 55
downstream ENSMUSE00000201921 Chr7:134136068..134136312 TAGCTGACCACTCGGGTCTT Chr7:134136103..134136122 59.87 55
downstream ENSMUSE00000201924 Chr7:134135789..134135986 CAGTTTCGATGGTGATGACG Chr7:134135807..134135826 60.11 50
downstream ENSMUSE00000201923 Chr7:134133060..134133446 AATTTCGATGGCTAGCTGGA Chr7:134133067..134133086 59.81 45
downstream ENSMUSE00000201926 Chr7:134132340..134132456 TCAGCTTCTGACTGGTCCAA Chr7:134132357..134132376 59.54 50
downstream ENSMUSE00000291837 Chr7:134131832..134131958 GAGCCTTCTCCCTCAATCCT Chr7:134131856..134131875 59.78 55
downstream ENSMUSE00000201927 Chr7:134130991..134131179 GCTCCATCTCTCGCACTTTC Chr7:134131115..134131134 60.1 55
downstream ENSMUSE00000519861 Chr7:134130383..134130628 ACGAGCCATCTGTGATGAGA Chr7:134130552..134130571 59.37 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCCCTTCCCTCTGTACCC Chr7:134145011..134145031 62.01 65 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCCCTTCCCTCTGTACCC Chr7:134145011..134145031 62.01 65 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030681