Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23828
Trapped Gene
Oaz2 (ENSMUSG00000040652)
Vector Insertion
Chr 9: 65536714 - 65536901
Public Clones not available
Private Clones OST243325 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000246230 (Chr9:65536628..65536713 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTCTTCATCTGCTTCAGGA Chr9:65536676..65536695 59.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000246230 (Chr9:65536628..65536713 +)
Downstram Exon
ENSMUSE00000246214 (Chr9:65536902..65538104 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTCTTCATCTGCTTCAGGA Chr9:65536676..65536695 59.11 50 AGGCAAGAGCTCTGGTGGTA Chr9:65537775..65537794 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000363133 Chr9:65524397..65524572 GAGCCACCGAGGATGATAAA Chr9:65524541..65524560 60.04 50
upstream ENSMUSE00000409150 Chr9:65534003..65534078 AGTAAGTGTCCCCAGCTCCA Chr9:65534019..65534038 59.72 55
upstream ENSMUSE00000346280 Chr9:65534080..65534160 CCTCACCCACTGTCGAAGAT Chr9:65534086..65534105 60.11 55
upstream ENSMUSE00000246250 Chr9:65535605..65535780 TCACCGAGGTGAAGGTCTCT Chr9:65535681..65535700 59.83 55
upstream ENSMUSE00000246230 Chr9:65536628..65536713 CGTCTTCATCTGCTTCAGGA Chr9:65536676..65536695 59.11 50

*** Putative Vector Insertion (Chr 9: 65536714 - 65536901) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000246214 Chr9:65536902..65538104 AGGCAAGAGCTCTGGTGGTA Chr9:65537775..65537794 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAAGACAGAGGTGAGCAG Chr9:65536703..65536723 59.99 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGAAGACAGAGGTGAGCAG Chr9:65536703..65536723 59.99 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040652