Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23830
Trapped Gene
Gabpb2 (ENSMUSG00000038766)
Vector Insertion
Chr 3: 95007652 - 95007848
Public Clones not available
Private Clones OST243238 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000494767 (Chr3:95007653..95007847 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCAGATGTGAACGCAAAG Chr3:95007824..95007843 60.46 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000494767 (Chr3:95007653..95007847 -)
Downstram Exon
ENSMUSE00000637761 (Chr3:95007653..95007847 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCAGATGTGAACGCAAAG Chr3:95007824..95007843 60.46 50 CATGTCCTTTGCGTTCACAT Chr3:95007796..95007815 59.57 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672406 Chr3:95021511..95021676 GTGAAAAGGCCGAAAAGTGA Chr3:95021600..95021619 60.23 45
upstream ENSMUSE00000672413 Chr3:95021511..95021631 GTGAAAAGGCCGAAAAGTGA Chr3:95021600..95021619 60.23 45
upstream ENSMUSE00000672417 Chr3:95021511..95021825 GTGAAAAGGCCGAAAAGTGA Chr3:95021600..95021619 60.23 45
upstream ENSMUSE00000672416 Chr3:95020136..95020190 ACTCCTGCGAGTTGTCCTGT Chr3:95020153..95020172 59.91 55
upstream ENSMUSE00000420483 Chr3:95012762..95012859 TTGGCTGTACTGGGACTTGA Chr3:95012831..95012850 59.29 50
upstream ENSMUSE00000672415 Chr3:95012762..95012858 TTGGCTGTACTGGGACTTGA Chr3:95012831..95012850 59.29 50
upstream ENSMUSE00000709675 Chr3:95010385..95010524 AAGGCCAAGACGATGAAGTG Chr3:95010427..95010446 60.26 50
upstream ENSMUSE00000710889 Chr3:95010385..95010524 AAGGCCAAGACGATGAAGTG Chr3:95010427..95010446 60.26 50
upstream ENSMUSE00000720201 Chr3:95010385..95010524 AAGGCCAAGACGATGAAGTG Chr3:95010427..95010446 60.26 50
upstream ENSMUSE00000253802 Chr3:95008563..95008730 AGAAGTGCTCCTTCGAGCTG Chr3:95008658..95008677 59.89 55
upstream ENSMUSE00000672409 Chr3:95008563..95008730 AGAAGTGCTCCTTCGAGCTG Chr3:95008658..95008677 59.89 55
upstream ENSMUSE00000494767 Chr3:95007653..95007847 GTGCAGATGTGAACGCAAAG Chr3:95007824..95007843 60.46 50
upstream ENSMUSE00000637761 Chr3:95007653..95007847 GTGCAGATGTGAACGCAAAG Chr3:95007824..95007843 60.46 50

*** Putative Vector Insertion (Chr 3: 95007652 - 95007848) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000672404 Chr3:95006935..95007847 ACACACCTGAAGCATGACCA Chr3:95007625..95007644 60.16 50
downstream ENSMUSE00000253781 Chr3:95004063..95004213 TGAACGGAGCAGTCACAGTC Chr3:95004110..95004129 60.03 55
downstream ENSMUSE00000566319 Chr3:95004040..95004213 TGAACGGAGCAGTCACAGTC Chr3:95004110..95004129 60.03 55
downstream ENSMUSE00000637758 Chr3:95003999..95004037 No primer for this exon
downstream ENSMUSE00000253769 Chr3:94994475..94994660 CTGGGTCGAGGAGTCAAGAG Chr3:94994589..94994608 59.98 60
downstream ENSMUSE00000253759 Chr3:94993076..94993206 GTCTCCTCTGCAACCTGACC Chr3:94993148..94993167 59.84 60
downstream ENSMUSE00000420468 Chr3:94991173..94992897 CTGTACTCCTGGGCTCTTCG Chr3:94992808..94992827 60.01 60
downstream ENSMUSE00000637762 Chr3:94985695..94992897 TCTACCCATCAGCAGCACAG Chr3:94990832..94990851 60.01 55
downstream ENSMUSE00000672412 Chr3:94985688..94992897 TCTACCCATCAGCAGCACAG Chr3:94990832..94990851 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTGCTTTTCTCCCAACAG Chr3:95007846..95007866 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTGCTTTTCTCCCAACAG Chr3:95007846..95007866 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038766