Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23838
Trapped Gene
CAAA01093111.1.1.7497 (ENSMUSG00000078814)
Vector Insertion
Chr 7: 3511258 - 3511355
Public Clones not available
Private Clones OST242927 (lexicon)
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677458 (Chr7:3511247..3511257 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677458 (Chr7:3511247..3511257 +)
Downstram Exon
ENSMUSE00000677457 (Chr7:3511356..3511625 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGGTGATGAAGTTCCCTCCT Chr7:3511474..3511493 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677460 Chr7:3510165..3510429 TTGGCCCAACTCAGTAGCAT Chr7:3510167..3510186 60.66 50
upstream ENSMUSE00000677459 Chr7:3510660..3510675 No primer for this exon
upstream ENSMUSE00000677458 Chr7:3511247..3511257 No primer for this exon

*** Putative Vector Insertion (Chr 7: 3511258 - 3511355) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000677457 Chr7:3511356..3511625 GGGTGATGAAGTTCCCTCCT Chr7:3511474..3511493 60.31 55
downstream ENSMUSE00000677456 Chr7:3512235..3512248 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCACCCCTTGCCCTTAAT Chr7:3511293..3511313 60.31 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000078814