Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23840
Trapped Gene
Tcfap4 (ENSMUSG00000005718)
Vector Insertion
Chr 16: 4551401 - 4551745
Public Clones not available
Private Clones OST242895 (lexicon) OST202967 (lexicon) OST166975 (lexicon) OST133653 (lexicon)
OST77203 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000127813 (Chr16:4551746..4551844 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000127813 (Chr16:4551746..4551844 -)
Downstram Exon
ENSMUSE00000395356 (Chr16:4551230..4551400 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000410136 Chr16:4559428..4559854 No primer for this exon
upstream ENSMUSE00000127814 Chr16:4551935..4552100 No primer for this exon
upstream ENSMUSE00000127813 Chr16:4551746..4551844 No primer for this exon

*** Putative Vector Insertion (Chr 16: 4551401 - 4551745) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000395356 Chr16:4551230..4551400 No primer for this exon
downstream ENSMUSE00000371658 Chr16:4549331..4549471 No primer for this exon
downstream ENSMUSE00000400961 Chr16:4547255..4547410 No primer for this exon
downstream ENSMUSE00000370959 Chr16:4544664..4545747 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGTGTCGTGACTGGGAAA Chr16:4551681..4551701 60.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005718