Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23877
Trapped Gene
Lrrc57 (ENSMUSG00000027286)
Vector Insertion
Chr 2: 120433804 - 120434408
Public Clones not available
Private Clones OST241781 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000167979 (Chr2:120434409..120434547 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGCCTACCGCCTCTGATA Chr2:120434461..120434480 59.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000167979 (Chr2:120434409..120434547 -)
Downstram Exon
ENSMUSE00000297944 (Chr2:120433535..120433803 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGCCTACCGCCTCTGATA Chr2:120434461..120434480 59.86 55 CGTCTTCAGGGCAGACAACT Chr2:120433669..120433688 60.44 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561498 Chr2:120435080..120435109 No primer for this exon
upstream ENSMUSE00000661758 Chr2:120435058..120435246 GATGATGTCACAGGGCGTTC Chr2:120435102..120435121 61.51 55
upstream ENSMUSE00000661761 Chr2:120435017..120435256 GATGATGTCACAGGGCGTTC Chr2:120435102..120435121 61.51 55
upstream ENSMUSE00000561495 Chr2:120435010..120435077 No primer for this exon
upstream ENSMUSE00000661755 Chr2:120434925..120435051 CCAAAGCATCAGGACCTTGT Chr2:120434926..120434945 60.11 50
upstream ENSMUSE00000717424 Chr2:120434851..120435091 CCAAAGCATCAGGACCTTGT Chr2:120434926..120434945 60.11 50
upstream ENSMUSE00000719859 Chr2:120434851..120435091 CCAAAGCATCAGGACCTTGT Chr2:120434926..120434945 60.11 50
upstream ENSMUSE00000641928 Chr2:120434654..120434759 AAACAGCGCAGAAAACTGGT Chr2:120434687..120434706 59.92 45
upstream ENSMUSE00000661757 Chr2:120434654..120434750 AAACAGCGCAGAAAACTGGT Chr2:120434687..120434706 59.92 45
upstream ENSMUSE00000661760 Chr2:120434654..120434759 AAACAGCGCAGAAAACTGGT Chr2:120434687..120434706 59.92 45
upstream ENSMUSE00000710054 Chr2:120434654..120434759 AAACAGCGCAGAAAACTGGT Chr2:120434687..120434706 59.92 45
upstream ENSMUSE00000167979 Chr2:120434409..120434547 ACAGCCTACCGCCTCTGATA Chr2:120434461..120434480 59.86 55

*** Putative Vector Insertion (Chr 2: 120433804 - 120434408) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297944 Chr2:120433535..120433803 CGTCTTCAGGGCAGACAACT Chr2:120433669..120433688 60.44 55
downstream ENSMUSE00000475057 Chr2:120431684..120431869 AAGAGATTGCCTTCCACAGC Chr2:120431702..120431721 59.43 50
downstream ENSMUSE00000641923 Chr2:120429976..120430994 AAGGGGGAGGAGTTACCAGA Chr2:120430081..120430100 59.93 55
downstream ENSMUSE00000661759 Chr2:120429974..120430994 AAGGGGGAGGAGTTACCAGA Chr2:120430081..120430100 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTTGTGTCTGGGCAGCTT Chr2:120434381..120434401 59.74 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTTGTGTCTGGGCAGCTT Chr2:120434381..120434401 59.74 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027286