Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23880
Trapped Gene
Manea (ENSMUSG00000040520)
Vector Insertion
Chr 4: 26268146 - 26273743
Public Clones not available
Private Clones OST241683 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000513950 (Chr4:26273744..26273799 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000513950 (Chr4:26273744..26273799 -)
Downstram Exon
ENSMUSE00000350540 (Chr4:26267564..26268145 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AAACTGGAGCCAATGTCGTC Chr4:26267625..26267644 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513950 Chr4:26273744..26273799 No primer for this exon

*** Putative Vector Insertion (Chr 4: 26268146 - 26273743) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000350540 Chr4:26267564..26268145 AAACTGGAGCCAATGTCGTC Chr4:26267625..26267644 60.12 50
downstream ENSMUSE00000241513 Chr4:26263768..26263877 CAGTAGCTTCGCCATTGTCA Chr4:26263796..26263815 60.01 50
downstream ENSMUSE00000241505 Chr4:26256233..26256309 No primer for this exon
downstream ENSMUSE00000382438 Chr4:26251657..26255455 GTTCCGGGTGTTCTGAGTGT Chr4:26255040..26255059 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr4:26273673..26273693 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCTTGTCTGCCTGGATGC Chr4:26270695..26270715 63.15 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040520