Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23890
Trapped Gene
Ngp (ENSMUSG00000032484)
Vector Insertion
Chr 9: 110323419 - 110324199
Public Clones not available
Private Clones OST241398 (lexicon) OST18054 (lexicon) OST6915 (lexicon)
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220031 (Chr9:110323317..110323418 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGACTGCGACTTCCTGGAG Chr9:110323393..110323412 59.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220031 (Chr9:110323317..110323418 +)
Downstram Exon
ENSMUSE00000220034 (Chr9:110324200..110324286 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGACTGCGACTTCCTGGAG Chr9:110323393..110323412 59.6 55 TCCCTGTGCAATTTCTCTCC Chr9:110324224..110324243 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000220032 Chr9:110322359..110322542 CCACTCCGCCTTCTAGTCAG Chr9:110322523..110322542 60.01 60
upstream ENSMUSE00000220031 Chr9:110323317..110323418 AAGACTGCGACTTCCTGGAG Chr9:110323393..110323412 59.6 55

*** Putative Vector Insertion (Chr 9: 110323419 - 110324199) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220034 Chr9:110324200..110324286 TCCCTGTGCAATTTCTCTCC Chr9:110324224..110324243 60.19 50
downstream ENSMUSE00000512367 Chr9:110324776..110325514 ATCCCCATTAAGGGATCTGG Chr9:110325445..110325464 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGACTGCGACTTCCTGGAG Chr9:110323394..110323414 59.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGACTGCGACTTCCTGGAG Chr9:110323394..110323414 59.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032484