Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI239
Trapped Gene
Arl15 (ENSMUSG00000042348)
Vector Insertion
Chr 13: 114724332 - 114757789
Public Clones GC0376 (tigem) XN886 (baygenomics) A041B03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307076 (Chr13:114724272..114724331 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCCAGAATGCCGTTTTGA Chr13:114724294..114724313 60.45 40 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307076 (Chr13:114724272..114724331 +)
Downstram Exon
ENSMUSE00000307071 (Chr13:114757790..114757998 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCCAGAATGCCGTTTTGA Chr13:114724294..114724313 60.45 40 CTTGGTAGTAGCGGCTCCAG Chr13:114757834..114757853 60.03 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679583 Chr13:114584767..114584904 CGGATAACTGAGGCGTTTCT Chr13:114584869..114584888 59.34 50
upstream ENSMUSE00000568635 Chr13:114712455..114712599 CGCCCTGAATATGACTTGGT Chr13:114712494..114712513 59.96 50
upstream ENSMUSE00000307076 Chr13:114724272..114724331 ATTCCAGAATGCCGTTTTGA Chr13:114724294..114724313 60.45 40

*** Putative Vector Insertion (Chr 13: 114724332 - 114757789) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307071 Chr13:114757790..114757998 CTTGGTAGTAGCGGCTCCAG Chr13:114757834..114757853 60.03 60
downstream ENSMUSE00000568639 Chr13:114944912..114947663 TGTAAAGCATCAGGCGTCAG Chr13:114947135..114947154 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCACAATAGCTTGGCCTCT Chr13:114748342..114748362 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGCACCGTGACTGGGAAAA Chr13:114748377..114748397 61.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042348