Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23905
Trapped Gene
Gpr114 (ENSMUSG00000061577)
Vector Insertion
Chr 8: 97458481 - 97458949
Public Clones not available
Private Clones OST240846 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000606285 (Chr8:97458361..97458480 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGCTGAGCTTCGACTCAT Chr8:97458427..97458446 60.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000606285 (Chr8:97458361..97458480 +)
Downstram Exon
ENSMUSE00000606284 (Chr8:97458950..97459066 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGCTGAGCTTCGACTCAT Chr8:97458427..97458446 60.7 55 TGGCTTCTGAAGGTTGTTCA Chr8:97459036..97459055 59.42 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606289 Chr8:97447594..97447657 CCATCTCGAGACAGCAGTGA Chr8:97447609..97447628 60.14 55
upstream ENSMUSE00000606288 Chr8:97457248..97457329 GAATACTGGCGAGGACATGG Chr8:97457250..97457269 60.48 55
upstream ENSMUSE00000606287 Chr8:97457396..97457471 No primer for this exon
upstream ENSMUSE00000606286 Chr8:97457775..97457931 TGCAGACAAACTCCATCCAG Chr8:97457837..97457856 59.83 50
upstream ENSMUSE00000606285 Chr8:97458361..97458480 CCTGCTGAGCTTCGACTCAT Chr8:97458427..97458446 60.7 55

*** Putative Vector Insertion (Chr 8: 97458481 - 97458949) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000606284 Chr8:97458950..97459066 TGGCTTCTGAAGGTTGTTCA Chr8:97459036..97459055 59.42 45
downstream ENSMUSE00000606283 Chr8:97460260..97460412 GTTGCAATGGCAGAGAACCT Chr8:97460388..97460407 60.26 50
downstream ENSMUSE00000606282 Chr8:97461124..97461242 CTGGACTGAGCGTACAGCAG Chr8:97461245..97461264 59.79 60
downstream ENSMUSE00000492941 Chr8:97461473..97461741 GAGCAAGTATCGGCGAATGT Chr8:97461722..97461741 60.24 50
downstream ENSMUSE00000606281 Chr8:97462441..97462558 CCTGGCTTTTGGAGAGTGAG Chr8:97462530..97462549 59.98 55
downstream ENSMUSE00000606280 Chr8:97465405..97465682 CACACCGAAGGAGAAGAAGG Chr8:97465636..97465655 59.84 55
downstream ENSMUSE00000606279 Chr8:97465932..97467180 GCAGAGAACCCTCTGTGGAG Chr8:97466976..97466995 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCACACCTCTTTCAGGTCA Chr8:97458466..97458486 60.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCACACCTCTTTCAGGTCA Chr8:97458466..97458486 60.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061577