Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23912
Trapped Gene
Actb (ENSMUSG00000029580)
Vector Insertion
Chr 5: 143667156 - 143667242
Public Clones not available
Private Clones OST240632 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648206 (Chr5:143667243..143667299 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTATTCCCCTCCATCGTG Chr5:143667261..143667280 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648206 (Chr5:143667243..143667299 -)
Downstram Exon
ENSMUSE00000510722 (Chr5:143666916..143667155 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTATTCCCCTCCATCGTG Chr5:143667261..143667280 60.33 55 CTTCTCCATGTCGTCCCAGT Chr5:143667005..143667024 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336366 Chr5:143668331..143668404 TTCTTTGCAGCTCCTTCGTT Chr5:143668353..143668372 60.13 45
upstream ENSMUSE00000648207 Chr5:143667302..143667361 No primer for this exon
upstream ENSMUSE00000511388 Chr5:143667243..143667371 CTGTATTCCCCTCCATCGTG Chr5:143667261..143667280 60.33 55
upstream ENSMUSE00000648206 Chr5:143667243..143667299 CTGTATTCCCCTCCATCGTG Chr5:143667261..143667280 60.33 55

*** Putative Vector Insertion (Chr 5: 143667156 - 143667242) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000510722 Chr5:143666916..143667155 CTTCTCCATGTCGTCCCAGT Chr5:143667005..143667024 60.11 55
downstream ENSMUSE00000517504 Chr5:143666023..143666461 GGGGTGTTGAAGGTCTCAAA Chr5:143666414..143666433 59.94 50
downstream ENSMUSE00000534432 Chr5:143665746..143665927 CGGATGTCAACGTCACACTT Chr5:143665839..143665858 59.6 50
downstream ENSMUSE00000706455 Chr5:143665420..143665620 GTACTTGCGCTCAGGAGGAG Chr5:143665572..143665591 60.16 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTAGGCACCAGGTAAGTG Chr5:143667234..143667254 59.61 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTAGGCACCAGGTAAGTG Chr5:143667234..143667254 59.61 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029580