Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23916
Trapped Gene
Rg9mtd3 (ENSMUSG00000035601)
Vector Insertion
Chr 4: 45317261 - 45318615
Public Clones not available
Private Clones OST240540 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000285924 (Chr4:45317136..45317260 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAGCAAACGCTTTTTGAA Chr4:45317150..45317169 60.03 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000285924 (Chr4:45317136..45317260 +)
Downstram Exon
ENSMUSE00000285916 (Chr4:45318616..45318768 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAGCAAACGCTTTTTGAA Chr4:45317150..45317169 60.03 40 TAAGCAGAAAACCCGTCGTT Chr4:45318767..45318786 59.75 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000285946 Chr4:45310040..45310067 No primer for this exon
upstream ENSMUSE00000285941 Chr4:45313289..45313499 TTCAGGAACCAGACGGACTC Chr4:45313366..45313385 60.24 55
upstream ENSMUSE00000674480 Chr4:45313306..45313499 TTCAGGAACCAGACGGACTC Chr4:45313366..45313385 60.24 55
upstream ENSMUSE00000285934 Chr4:45314108..45314222 GCAGGAAAGAGAACGAAGGA Chr4:45314173..45314192 59.55 50
upstream ENSMUSE00000674478 Chr4:45314108..45314216 GCAGGAAAGAGAACGAAGGA Chr4:45314173..45314192 59.55 50
upstream ENSMUSE00000285924 Chr4:45317136..45317260 CACAGCAAACGCTTTTTGAA Chr4:45317150..45317169 60.03 40

*** Putative Vector Insertion (Chr 4: 45317261 - 45318615) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000285916 Chr4:45318616..45318768 TAAGCAGAAAACCCGTCGTT Chr4:45318767..45318786 59.75 45
downstream ENSMUSE00000285907 Chr4:45320764..45320842 ACACAAGGGTTTCCAGAGGA Chr4:45320821..45320840 59.55 50
downstream ENSMUSE00000285897 Chr4:45321369..45321436 No primer for this exon
downstream ENSMUSE00000285886 Chr4:45327155..45327278 TGGCGCTTGATCATGTATTC Chr4:45327237..45327256 59.65 45
downstream ENSMUSE00000285877 Chr4:45327884..45329003 GCAGGTGGTAAGAGCTGAGG Chr4:45328825..45328844 60.01 60
downstream ENSMUSE00000674476 Chr4:45327884..45328014 GCTTCAGGCCAGTTACGAGT Chr4:45327935..45327954 59.5 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGACCCAGCACATGTCAAA Chr4:45317238..45317258 59.97 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGACCCAGCACATGTCAAA Chr4:45317238..45317258 59.97 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035601