Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23928
Trapped Gene
Mllt4 (ENSMUSG00000068036)
Vector Insertion
Chr 17: 13899011 - 13940945
Public Clones not available
Private Clones OST240263 (lexicon) OST56820 (lexicon) OST42177 (lexicon) OST39369 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703721 (Chr17:13898612..13899010 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTTAATTTTGCCGGTGGA Chr17:13898895..13898914 59.94 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703721 (Chr17:13898612..13899010 +)
Downstram Exon
ENSMUSE00000242801 (Chr17:13940946..13941141 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTTAATTTTGCCGGTGGA Chr17:13898895..13898914 59.94 45 CTTGAGTGGTGGCTGTGCTA Chr17:13941051..13941070 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703721 Chr17:13898612..13899010 GACTTAATTTTGCCGGTGGA Chr17:13898895..13898914 59.94 45

*** Putative Vector Insertion (Chr 17: 13899011 - 13940945) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000242801 Chr17:13940946..13941141 CTTGAGTGGTGGCTGTGCTA Chr17:13941051..13941070 60.05 55
downstream ENSMUSE00000136121 Chr17:13944284..13944399 AATGGCGTCATTCTCGTTCT Chr17:13944393..13944412 59.7 45
downstream ENSMUSE00000136125 Chr17:13945939..13946102 TCCTGCTTTTCAGGTCCATT Chr17:13945973..13945992 59.67 45
downstream ENSMUSE00000403483 Chr17:13947417..13947577 GCTCCGAAACTCTTGCATTC Chr17:13947558..13947577 59.96 50
downstream ENSMUSE00000433661 Chr17:13955128..13955285 TTCGGCTACAGCAAAGTCTG Chr17:13955231..13955250 59.22 50
downstream ENSMUSE00000480607 Chr17:13959273..13959384 CTTTGTCACTTGGCCATTCC Chr17:13959387..13959406 60.49 50
downstream ENSMUSE00000513922 Chr17:13960298..13960465 TGTAGTCCGGTGGTCTCCTC Chr17:13960342..13960361 60.11 60
downstream ENSMUSE00000433633 Chr17:13965936..13966030 GGCGGTATAACTTTGGCTTG Chr17:13965977..13965996 59.61 50
downstream ENSMUSE00000433627 Chr17:13966877..13967139 GGATGGGGTCCACAAACTTA Chr17:13967072..13967091 59.65 50
downstream ENSMUSE00000433619 Chr17:13969375..13969444 TGGACATCTCCTCCCAATTC Chr17:13969419..13969438 59.86 50
downstream ENSMUSE00000433614 Chr17:13972245..13972363 TCGTCGATATTCCTGCTCCT Chr17:13972355..13972374 59.8 50
downstream ENSMUSE00000433610 Chr17:13983279..13983340 GCTGGCAGGCAGTATCAGTT Chr17:13983324..13983343 60.43 55
downstream ENSMUSE00000433604 Chr17:13983441..13983646 TGGCTGGACAATACATACCG Chr17:13983558..13983577 59.42 50
downstream ENSMUSE00000433599 Chr17:13986115..13986260 CGACTAAGGTCTCGGTCCTG Chr17:13986209..13986228 59.86 60
downstream ENSMUSE00000433594 Chr17:13986575..13986669 CCAGAAAGGCTGGCATGTAG Chr17:13986633..13986652 60.79 55
downstream ENSMUSE00000433589 Chr17:13987787..13988052 GAAGAGCTGGATGGTCAAGG Chr17:13987872..13987891 59.8 55
downstream ENSMUSE00000433583 Chr17:13989323..13989466 ATCGGGTGCACAGTGGTAAT Chr17:13989451..13989470 60.26 50
downstream ENSMUSE00000703720 Chr17:13990927..13990941 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCATTCATTGGACTCAG Chr17:13917041..13917061 59.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCATTCATTGGACTCAG Chr17:13917041..13917061 59.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068036