Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23934
Trapped Gene
Msl2l1 (ENSMUSG00000066415)
Vector Insertion
Chr 9: 100979145 - 101002900
Public Clones IST13057A5 (tigm)
Private Clones OST240105 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000530687 (Chr9:100978486..100979144 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCGCTGATTTCGCTTGTCT Chr9:100978753..100978772 59.99 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000530687 (Chr9:100978486..100979144 +)
Downstram Exon
ENSMUSE00000530686 (Chr9:101002901..101006727 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCGCTGATTTCGCTTGTCT Chr9:100978753..100978772 59.99 45 GCCAGTGTCGTCTGGGTTAT Chr9:101003108..101003127 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000530687 Chr9:100978486..100979144 ATCGCTGATTTCGCTTGTCT Chr9:100978753..100978772 59.99 45

*** Putative Vector Insertion (Chr 9: 100979145 - 101002900) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000530686 Chr9:101002901..101006727 GCCAGTGTCGTCTGGGTTAT Chr9:101003108..101003127 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCACTAGAGTCCTGCATCC Chr9:101000137..101000157 59.83 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCACTAGAGTCCTGCATCC Chr9:101000137..101000157 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066415