Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23948
Trapped Gene
Camkv (ENSMUSG00000032936)
Vector Insertion
Chr 9: 107838383 - 107847609
Public Clones (ggtc)
Private Clones OST239724 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000337061 (Chr9:107838251..107838382 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTATCGCTTCCTGCCTGTG Chr9:107838346..107838365 60.8 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000337061 (Chr9:107838251..107838382 +)
Downstram Exon
ENSMUSE00000249734 (Chr9:107847610..107847713 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTATCGCTTCCTGCCTGTG Chr9:107838346..107838365 60.8 55 CTGTCAGTCACTTCCGATGG Chr9:107847689..107847708 59.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337061 Chr9:107838251..107838382 GTTATCGCTTCCTGCCTGTG Chr9:107838346..107838365 60.8 55

*** Putative Vector Insertion (Chr 9: 107838383 - 107847609) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000249734 Chr9:107847610..107847713 CTGTCAGTCACTTCCGATGG Chr9:107847689..107847708 59.26 55
downstream ENSMUSE00000249710 Chr9:107847820..107847951 CCATCACGCTTCTGGAACTT Chr9:107847906..107847925 60.26 50
downstream ENSMUSE00000249690 Chr9:107848121..107848195 GAAGTATTCCTTGCGGGTCA Chr9:107848184..107848203 60.07 50
downstream ENSMUSE00000249667 Chr9:107848410..107848548 TCTCGCTCCGAGTAGTAGCC Chr9:107848472..107848491 59.74 60
downstream ENSMUSE00000249637 Chr9:107848671..107848791 CAGGTGAAAGTCGCTGATGA Chr9:107848739..107848758 59.98 50
downstream ENSMUSE00000249608 Chr9:107848949..107849024 CCAATGGCCCAACAGTCTAC Chr9:107849009..107849028 60.38 55
downstream ENSMUSE00000249586 Chr9:107849114..107849250 TCGTCCCAGTACGGAGAGTC Chr9:107849239..107849258 60.26 60
downstream ENSMUSE00000249561 Chr9:107849413..107849491 No primer for this exon
downstream ENSMUSE00000249534 Chr9:107849711..107849798 AGACGCCATCCTTGATGTTC Chr9:107849760..107849779 60.08 50
downstream ENSMUSE00000341125 Chr9:107850075..107852021 TGTTCCAGACTGCTCTGGTG Chr9:107850137..107850156 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTTGCATAGTGGGGACTG Chr9:107841407..107841427 58.62 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGACGTGACTGGGAAAAC Chr9:107841429..107841449 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032936