Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23952
Trapped Gene
Spats1 (ENSMUSG00000023935)
Vector Insertion
Chr 17: 45601533 - 45603642
Public Clones IST11412B1 (tigm) IST13058D12 (tigm) IST11907F12BBF1 (tigm) IST11873C1 (tigm)
IST11899E6 (tigm) IST11899F2 (tigm) IST11891F1BBF1 (tigm) IST11721B12 (tigm)
IST14685A1 (tigm) IST11910B4BBF1 (tigm) IST11931B12 (tigm)
Private Clones OST239507 (lexicon) OST67415 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696141 (Chr17:45603643..45603655 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696141 (Chr17:45603643..45603655 -)
Downstram Exon
ENSMUSE00000696140 (Chr17:45601376..45601532 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCAGAAGACGAGAGGCTGGT Chr17:45601414..45601433 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696133 Chr17:45611748..45611893 GCATCCTGGTATTTGGCAGT Chr17:45611804..45611823 59.96 50
upstream ENSMUSE00000696141 Chr17:45603643..45603655 No primer for this exon

*** Putative Vector Insertion (Chr 17: 45601533 - 45603642) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696132 Chr17:45601376..45601529 TCAGAAGACGAGAGGCTGGT Chr17:45601414..45601433 60.13 55
downstream ENSMUSE00000696140 Chr17:45601376..45601532 TCAGAAGACGAGAGGCTGGT Chr17:45601414..45601433 60.13 55
downstream ENSMUSE00000657303 Chr17:45598111..45598259 GCGAAACTTTTGAGGAACGA Chr17:45598149..45598168 60.37 45
downstream ENSMUSE00000657302 Chr17:45594107..45594268 GGATGTTGCTGCTGAACCTT Chr17:45594193..45594212 60.26 50
downstream ENSMUSE00000657301 Chr17:45591040..45591160 GGATTATCCCCTGGTGTCAA Chr17:45591090..45591109 59.6 50
downstream ENSMUSE00000657300 Chr17:45589627..45589689 TTTTGGAAGTGGCTCAAGTG Chr17:45589613..45589632 58.9 45
downstream ENSMUSE00000657299 Chr17:45586384..45586499 CTGCCAGTTGTCAAGCTCCT Chr17:45586399..45586418 60.59 55
downstream ENSMUSE00000657297 Chr17:45585886..45586140 GTGTTCAACAAGGCCAAACA Chr17:45585934..45585953 59.59 45
downstream ENSMUSE00000657298 Chr17:45582830..45583032 ATGAGAGGATGTCCGGTGAG Chr17:45582856..45582875 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr17:45603571..45603591 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAATCGCCTTGCAGCACATC Chr17:45603585..45603605 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000023935