Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23960
Trapped Gene
Sfrs18 (ENSMUSG00000028248)
Vector Insertion
Chr 4: 21781493 - 21781593
Public Clones not available
Private Clones OST239320 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676011 (Chr4:21781392..21781592 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAACAGTGGATGCAGTCAT Chr4:21781552..21781571 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676011 (Chr4:21781392..21781592 +)
Downstram Exon
ENSMUSE00000716923 (Chr4:21781494..21781592 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAACAGTGGATGCAGTCAT Chr4:21781552..21781571 59.71 50 ATGACTGCATCCACTGTTGC Chr4:21781574..21781593 59.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000366146 Chr4:21775195..21775286 AAGCATCGAAAGGTTGGAGA Chr4:21775221..21775240 59.81 45
upstream ENSMUSE00000633265 Chr4:21775202..21775286 AAGCATCGAAAGGTTGGAGA Chr4:21775221..21775240 59.81 45
upstream ENSMUSE00000676010 Chr4:21775205..21775286 AAGCATCGAAAGGTTGGAGA Chr4:21775221..21775240 59.81 45
upstream ENSMUSE00000676011 Chr4:21781392..21781592 GCAACAGTGGATGCAGTCAT Chr4:21781552..21781571 59.71 50

*** Putative Vector Insertion (Chr 4: 21781493 - 21781593) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000381194 Chr4:21781494..21781592 ATGACTGCATCCACTGTTGC Chr4:21781574..21781593 59.71 50
downstream ENSMUSE00000716923 Chr4:21781494..21781592 ATGACTGCATCCACTGTTGC Chr4:21781574..21781593 59.71 50
downstream ENSMUSE00000177591 Chr4:21784327..21784515 TACGATGCTTTGCTGTCCTG Chr4:21784403..21784422 60.01 50
downstream ENSMUSE00000177602 Chr4:21786231..21786454 GTGGTCCACCAAAGTTGTGA Chr4:21786413..21786432 59.42 50
downstream ENSMUSE00000177589 Chr4:21787967..21788138 GAGGTCCTGGTTGCCAATAA Chr4:21788033..21788052 59.93 50
downstream ENSMUSE00000177587 Chr4:21789134..21789324 TCTCAAGGCCTTCACGAATC Chr4:21789187..21789206 60.34 50
downstream ENSMUSE00000177594 Chr4:21793024..21793161 TCCTCTTCCGTCATCTCTGG Chr4:21793148..21793167 60.34 55
downstream ENSMUSE00000177600 Chr4:21796663..21796762 TGACGTCCAGGAGAATTTCA Chr4:21796711..21796730 59.22 45
downstream ENSMUSE00000633264 Chr4:21796663..21798489 TTACTCCCCACCCAGAAGTG Chr4:21798189..21798208 59.96 55
downstream ENSMUSE00000177592 Chr4:21797499..21797552 No primer for this exon
downstream ENSMUSE00000676012 Chr4:21798585..21798755 TTCTTGTTTTTGCCGGATTC Chr4:21798703..21798722 60.05 40
downstream ENSMUSE00000344416 Chr4:21800733..21801819 GACTGGAACGATTGGTTCGT Chr4:21801305..21801324 59.97 50
downstream ENSMUSE00000633260 Chr4:21800733..21803614 GACTGGAACGATTGGTTCGT Chr4:21801305..21801324 59.97 50
downstream ENSMUSE00000432876 Chr4:21802060..21803614 CGCTAGACCGTTCACTAGCC Chr4:21802993..21803012 60.04 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGATGTGGGATCAAGGAG Chr4:21781502..21781522 58.94 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGATGTGGGATCAAGGAG Chr4:21781502..21781522 58.94 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028248