Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23968
Trapped Gene
Gramd1b (ENSMUSG00000040111)
Vector Insertion
Chr 9: 40135024 - 40141029
Public Clones IST11621A12 (tigm)
Private Clones OST239093 (lexicon) OST232742 (lexicon) OST230085 (lexicon) OST131714 (lexicon)
OST108807 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715720 (Chr9:40141030..40141240 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCGGTGGTAAAAATTCCA Chr9:40141032..40141051 59.94 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715720 (Chr9:40141030..40141240 -)
Downstram Exon
ENSMUSE00000507398 (Chr9:40135003..40135023 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCGGTGGTAAAAATTCCA Chr9:40141032..40141051 59.94 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712342 Chr9:40338605..40338968 AGGTATCTCCGACTGGATCG Chr9:40338801..40338820 59.12 55
upstream ENSMUSE00000347263 Chr9:40262879..40263349 AACTGCCGTCCATTGAGATT Chr9:40263007..40263026 59.56 45
upstream ENSMUSE00000393136 Chr9:40220882..40220959 ACGATGATTCGAGCAGGTTC Chr9:40220908..40220927 60.23 50
upstream ENSMUSE00000714797 Chr9:40199265..40199737 TTCTGGGTGGACATTTGTGA Chr9:40199347..40199366 59.94 45
upstream ENSMUSE00000709787 Chr9:40153493..40153875 CCAGCCTATGTAAGCCGTGT Chr9:40153657..40153676 60.15 55
upstream ENSMUSE00000334158 Chr9:40141030..40141240 GAGCGGTGGTAAAAATTCCA Chr9:40141032..40141051 59.94 45
upstream ENSMUSE00000715720 Chr9:40141030..40141240 GAGCGGTGGTAAAAATTCCA Chr9:40141032..40141051 59.94 45
upstream ENSMUSE00000720187 Chr9:40141021..40141240 GAGCGGTGGTAAAAATTCCA Chr9:40141032..40141051 59.94 45

*** Putative Vector Insertion (Chr 9: 40135024 - 40141029) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000507398 Chr9:40135003..40135023 No primer for this exon
downstream ENSMUSE00000152013 Chr9:40125094..40125178 TCCGTGTCTGGAAGTTGCTT Chr9:40125086..40125105 60.83 50
downstream ENSMUSE00000347140 Chr9:40124450..40124553 AGGTAGAGTCGGCCCTGAAG Chr9:40124480..40124499 60.78 60
downstream ENSMUSE00000272680 Chr9:40123273..40123368 TGAGGCGAGCTGTTTTCTCT Chr9:40123289..40123308 60.28 50
downstream ENSMUSE00000272648 Chr9:40122552..40122632 TTTTCAAGGAGAGCATTCTGC Chr9:40122531..40122551 59.58 42.86
downstream ENSMUSE00000272626 Chr9:40119343..40119458 GGAGGCACGTAGTCCTCATC Chr9:40119345..40119364 59.69 60
downstream ENSMUSE00000272606 Chr9:40117483..40117639 TTCCCGTAGACGTCAGTGTG Chr9:40117481..40117500 59.74 55
downstream ENSMUSE00000333550 Chr9:40115878..40116067 GTTGTCAATGGCAAGCTCCT Chr9:40115971..40115990 60.26 50
downstream ENSMUSE00000418157 Chr9:40115441..40115584 TGTCCACGCTGAAGTTGAAG Chr9:40115488..40115507 60.03 50
downstream ENSMUSE00000364853 Chr9:40114325..40114443 TCACTCGACTCTGGTTTCCA Chr9:40114368..40114387 59.39 50
downstream ENSMUSE00000272812 Chr9:40113917..40114059 ACATCGTGGGTGAGGACTTC Chr9:40113970..40113989 59.97 55
downstream ENSMUSE00000272796 Chr9:40112651..40112754 GATAGCGGAGCTCTGTGGAG Chr9:40112710..40112729 60.12 60
downstream ENSMUSE00000272772 Chr9:40111908..40112111 CTTCATCAGTGGGTGTGGTG Chr9:40111916..40111935 60 55
downstream ENSMUSE00000272748 Chr9:40111083..40111173 ACAGCTGATAACCAGCAGCA Chr9:40111063..40111082 59.62 50
downstream ENSMUSE00000716799 Chr9:40108025..40108036 No primer for this exon
downstream ENSMUSE00000403392 Chr9:40107574..40107681 TGAGGGTCTGGGTGGTGTAT Chr9:40107583..40107602 60.24 55
downstream ENSMUSE00000367388 Chr9:40107187..40107304 AGCTCGGTGTCGTGGTACTT Chr9:40107214..40107233 59.79 55
downstream ENSMUSE00000717944 Chr9:40105531..40105664 TTCCTCTTCTCGTCGCTCTC Chr9:40105566..40105585 59.83 55
downstream ENSMUSE00000339314 Chr9:40105492..40105664 TTCCTCTTCTCGTCGCTCTC Chr9:40105566..40105585 59.83 55
downstream ENSMUSE00000711659 Chr9:40105461..40105664 TTCCTCTTCTCGTCGCTCTC Chr9:40105566..40105585 59.83 55
downstream ENSMUSE00000715641 Chr9:40100824..40102012 ACATGCTGGGGTAGATCGTC Chr9:40101441..40101460 59.96 55
downstream ENSMUSE00000720137 Chr9:40100818..40105664 GGCGACTATGCTCACTCCTC Chr9:40104454..40104473 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr9:40141002..40141022 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCCTTTGTTAGCTGGTC Chr9:40140983..40141003 60.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAGCACTGCCAGTAACTCCA Chr9:40141222..40141242 60.05 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGCACTGCCAGTAACTCCA Chr9:40141222..40141242 60.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040111