Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23977
Trapped Gene
Rsbn1 (ENSMUSG00000044098)
Vector Insertion
Chr 3: 103718042 - 103719077
Public Clones not available
Private Clones OST238962 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713542 (Chr3:103718043..103719076 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACATTGTTTGGGCGGTTAG Chr3:103718115..103718134 59.86 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713542 (Chr3:103718043..103719076 +)
Downstram Exon
ENSMUSE00000458938 (Chr3:103718043..103719076 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACATTGTTTGGGCGGTTAG Chr3:103718115..103718134 59.86 45 TCGGTCGTTCTCGTAGACCT Chr3:103718402..103718421 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 3: 103718042 - 103719077) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000458938 Chr3:103718043..103719076 TCGGTCGTTCTCGTAGACCT Chr3:103718402..103718421 59.87 55
downstream ENSMUSE00000713542 Chr3:103718043..103719076 TCGGTCGTTCTCGTAGACCT Chr3:103718402..103718421 59.87 55
downstream ENSMUSE00000671213 Chr3:103718500..103719076 TGTCCTTGTGCTTGAGATCG Chr3:103719022..103719041 59.98 50
downstream ENSMUSE00000386733 Chr3:103732274..103732947 ACGCAGCGTTTTTCTCATTT Chr3:103732798..103732817 59.89 40
downstream ENSMUSE00000341134 Chr3:103757560..103757697 GCATAGGACCTGCTCGGTAG Chr3:103757608..103757627 59.86 60
downstream ENSMUSE00000373167 Chr3:103758028..103758170 ACATTATAGGCCCGTCATCG Chr3:103758106..103758125 59.81 50
downstream ENSMUSE00000338095 Chr3:103763926..103764093 GGGTTCACTTGTCCGAGGTA Chr3:103763980..103763999 59.97 55
downstream ENSMUSE00000381614 Chr3:103765396..103765504 TTTGGTTATGCGAGGCTGAT Chr3:103765423..103765442 60.61 45
downstream ENSMUSE00000352436 Chr3:103766083..103766538 TCCAGTCTGCTCTCCACCTT Chr3:103766489..103766508 59.99 55
downstream ENSMUSE00000458928 Chr3:103766083..103770543 CGCCAGGCAAATTAAACATT Chr3:103770295..103770314 59.96 40
downstream ENSMUSE00000671210 Chr3:103766083..103770559 CGCCAGGCAAATTAAACATT Chr3:103770295..103770314 59.96 40
downstream ENSMUSE00000588035 Chr3:103768497..103770536 CGCCAGGCAAATTAAACATT Chr3:103770295..103770314 59.96 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGGAACACTGGAAGTGGA Chr3:103718061..103718081 60.09 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGGAACACTGGAAGTGGA Chr3:103718061..103718081 60.09 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044098