Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2398
Trapped Gene
AC121108.12 (ENSMUSG00000027630)
Vector Insertion
Chr 3: 21975877 - 22047863
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) AC0697 (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) XS0613 (sanger)
(sanger) (sanger) P143H01 (ggtc) E079F03 (ggtc) D158C01 (ggtc)
D080A09 (ggtc) D060D10 (ggtc) D035C07 (ggtc) (ggtc) (ggtc)
P140D02 (ggtc) D188E03 (ggtc) D102B01 (ggtc) D063D09 (ggtc) D057F11 (ggtc)
D029H07 (ggtc) (ggtc) D035C07 (ggtc) P123G04 (ggtc) D158D01 (ggtc)
D088H02 (ggtc) D062F08 (ggtc) D042B05 (ggtc) (ggtc) P143A07 (ggtc)
E054F11 (ggtc) D158B01 (ggtc) D074B06 (ggtc) D059A07 (ggtc) D029H08 (ggtc)
(ggtc) P133D06 (ggtc) D187A08 (ggtc) D089F11 (ggtc) D063D09 (ggtc)
D051B04 (ggtc) D023G04 (ggtc) (ggtc) W195B06 (ggtc) E088E04 (ggtc)
D158C01 (ggtc) D080A09 (ggtc) D060D10 (ggtc) D035C07 (ggtc) (ggtc)
P140D02 (ggtc) E042H02 (ggtc) D130A10 (ggtc) D074B05 (ggtc) D059A07 (ggtc)
D029H08 (ggtc) (ggtc) P123G04 (ggtc) D183F07 (ggtc) D088H02 (ggtc)
D062F08 (ggtc) D051B04 (ggtc) (ggtc) PST24784-NR (escells) PST19807-NR (escells)
IST12743E12 (tigm) IST13048D5 (tigm) IST13209B4 (tigm) IST14184C2 (tigm)
IST14209G7 (tigm) IST14221D3 (tigm) IST15000H10 (tigm) IST14178F7 (tigm)
IST14552G2 (tigm) IST14142B3 (tigm) IST15007H8 (tigm) IST11623C9 (tigm)
IST14434A4 (tigm) IST14208H6 (tigm) IST12738A12 (tigm) IST11196A7 (tigm)
IST13087F7 (tigm) IST14611D2 (tigm) IST12952F10 (tigm) IST14311A1 (tigm)
IST14514F10 (tigm) IST14386G4 (tigm) IST14333C9 (tigm) IST14138E6 (tigm)
IST14977B10 (tigm) IST13635D3 (tigm) IST10930G5 (tigm) IST14374B5 (tigm)
IST10726A6 (tigm) IST14709C7 (tigm) IST12819E3 (tigm) IST13043A6 (tigm)
IST14345D12 (tigm)
Private Clones OST471018 (lexicon) OST461491 (lexicon) OST448836 (lexicon) OST446049 (lexicon)
OST425285 (lexicon) OST415150 (lexicon) OST364332 (lexicon) OST325757 (lexicon)
OST322954 (lexicon) OST321467 (lexicon) OST277310 (lexicon) OST270305 (lexicon)
OST193965 (lexicon) OST183007 (lexicon) OST181404 (lexicon) OST167774 (lexicon)
OST166996 (lexicon) OST147902 (lexicon) OST88948 (lexicon) OST78736 (lexicon)
OST68095 (lexicon) OST56010 (lexicon) OST52069 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000428268 (Chr3:21975706..21975876 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTAGTAACAGCTCCCCTCCT Chr3:21975706..21975727 60.14 54.54 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000428268 (Chr3:21975706..21975876 +)
Downstram Exon
ENSMUSE00000305564 (Chr3:22047864..22047930 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTAGTAACAGCTCCCCTCCT Chr3:21975706..21975727 60.14 54.54 CATTGGCAGTGCATTGATGT Chr3:22047933..22047952 60.55 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000428268 Chr3:21975706..21975876 CCTTAGTAACAGCTCCCCTCCT Chr3:21975706..21975727 60.14 54.54

*** Putative Vector Insertion (Chr 3: 21975877 - 22047863) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000305564 Chr3:22047864..22047930 CATTGGCAGTGCATTGATGT Chr3:22047933..22047952 60.55 45
downstream ENSMUSE00000392747 Chr3:22078125..22078227 TGAGGTCACAACACAGGACA Chr3:22078152..22078171 58.62 50
downstream ENSMUSE00000171326 Chr3:22087288..22087433 AGGGCACCATTTATGTTGGA Chr3:22087360..22087379 60.19 45
downstream ENSMUSE00000171318 Chr3:22088690..22088912 CTACATCGGGCATAACAGCA Chr3:22088762..22088781 59.71 50
downstream ENSMUSE00000171314 Chr3:22089837..22089969 AAGCACAACCGCTTTATTGG Chr3:22089907..22089926 60.13 45
downstream ENSMUSE00000171330 Chr3:22090314..22090455 CTCCTTCCCGTATGCAGTGT Chr3:22090411..22090430 60.13 55
downstream ENSMUSE00000171313 Chr3:22090942..22091005 TCCATATTCTGGCAAATCCA Chr3:22090999..22091018 58.92 40
downstream ENSMUSE00000171312 Chr3:22091092..22091189 CGCCAGCACTTAGGATGAAA Chr3:22091184..22091203 61.29 50
downstream ENSMUSE00000171324 Chr3:22092030..22092090 TGCTTGGCTTCACCAGTATG Chr3:22092073..22092092 59.86 50
downstream ENSMUSE00000171328 Chr3:22099242..22099363 TTGCTCTGCCAGTCAACATC Chr3:22099275..22099294 59.99 50
downstream ENSMUSE00000569264 Chr3:22099512..22099586 GTTGGGTCCCATTTGATAGC Chr3:22099546..22099565 59.25 50
downstream ENSMUSE00000569262 Chr3:22102019..22102146 TGGTCCTGTTGGACTCCACT Chr3:22102111..22102130 60.56 55
downstream ENSMUSE00000569261 Chr3:22102749..22102914 CACTGTACACGGGCTCTTGA Chr3:22102843..22102862 59.9 55
downstream ENSMUSE00000305477 Chr3:22108434..22108535 AGCACTGGCTCCAACTTTGT Chr3:22108526..22108545 59.91 50
downstream ENSMUSE00000427866 Chr3:22109323..22110890 GCTACTTAGGGGCACAGCAG Chr3:22109594..22109613 60.04 60
downstream ENSMUSE00000705945 Chr3:22109323..22110455 GCTACTTAGGGGCACAGCAG Chr3:22109594..22109613 60.04 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGTCCGTTCCTGTTTTCC Chr3:22035897..22035917 59.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCCGTGACTGGGAAAACC Chr3:22035924..22035944 62.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027630