Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24004
Trapped Gene
Tcp1 (ENSMUSG00000068039)
Vector Insertion
Chr 17: 13116560 - 13117125
Public Clones not available
Private Clones OST238035 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000555804 (Chr17:13116396..13116559 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTCGGGAACAGCTTGCTA Chr17:13116398..13116417 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000555804 (Chr17:13116396..13116559 +)
Downstram Exon
ENSMUSE00000555801 (Chr17:13117126..13117422 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTCGGGAACAGCTTGCTA Chr17:13116398..13116417 59.98 50 GCGAACTTCAGGCTCTTCAC Chr17:13117224..13117243 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000555829 Chr17:13109331..13109495 AGCTTTGCTTCGTTTCCTGA Chr17:13109410..13109429 60.13 45
upstream ENSMUSE00000555828 Chr17:13110664..13110749 GCCAGTTGGCTTGGATAAAA Chr17:13110710..13110729 60.07 45
upstream ENSMUSE00000555827 Chr17:13110909..13111037 GCAGCCAAAGTTCTGTGTGA Chr17:13110969..13110988 60.03 50
upstream ENSMUSE00000555826 Chr17:13112217..13112314 TAATCATTGCAGCGGAGCTT Chr17:13112218..13112237 60.88 45
upstream ENSMUSE00000555822 Chr17:13112681..13112791 GCGGTGCGTTATATCAATGAG Chr17:13112685..13112705 60.49 47.62
upstream ENSMUSE00000555820 Chr17:13113142..13113323 TATGCGCTCAATTGTGTGGT Chr17:13113293..13113312 60.14 45
upstream ENSMUSE00000555817 Chr17:13113606..13113732 CTTCAGCCTGCAGAAAACAA Chr17:13113649..13113668 59.19 45
upstream ENSMUSE00000555815 Chr17:13114969..13115144 CTAACCACTGGTGGCATTGA Chr17:13115030..13115049 59.57 50
upstream ENSMUSE00000555811 Chr17:13115475..13115598 CGGAAGAGGTCGTACAGGAG Chr17:13115544..13115563 59.86 60
upstream ENSMUSE00000555808 Chr17:13116084..13116276 GGTGGAGGTGCTGTAGAAGC Chr17:13116217..13116236 59.87 60
upstream ENSMUSE00000555804 Chr17:13116396..13116559 ATCTCGGGAACAGCTTGCTA Chr17:13116398..13116417 59.98 50

*** Putative Vector Insertion (Chr 17: 13116560 - 13117125) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000555801 Chr17:13117126..13117422 GCGAACTTCAGGCTCTTCAC Chr17:13117224..13117243 60.14 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTAATCGCCTTGCAGCAC Chr17:13116608..13116628 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAACCCGGAACGTAAAAAT Chr17:13116533..13116553 59.31 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068039