Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24005
Trapped Gene
Nr4a1 (ENSMUSG00000023034)
Vector Insertion
Chr 15: 101097403 - 101100513
Public Clones D174C06 (ggtc) D050C12 (ggtc)
Private Clones OST238017 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000132954 (Chr15:101097284..101097402 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGGGGAGTGTGCTAGAAG Chr15:101097304..101097323 60.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000132954 (Chr15:101097284..101097402 +)
Downstram Exon
ENSMUSE00000132956 (Chr15:101100514..101101400 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGGGGAGTGTGCTAGAAG Chr15:101097304..101097323 60.25 55 GTAGGCTTGCCGAACTCAAG Chr15:101100619..101100638 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000132954 Chr15:101097284..101097402 TTGGGGGAGTGTGCTAGAAG Chr15:101097304..101097323 60.25 55

*** Putative Vector Insertion (Chr 15: 101097403 - 101100513) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000132956 Chr15:101100514..101101400 GTAGGCTTGCCGAACTCAAG Chr15:101100619..101100638 60.01 55
downstream ENSMUSE00000132957 Chr15:101102167..101102296 GCAGATGTACTTGGCGCTTT Chr15:101102202..101102221 60.42 50
downstream ENSMUSE00000132955 Chr15:101102584..101102735 GATTGGTAGGGGAGGCATCT Chr15:101102670..101102689 60.29 55
downstream ENSMUSE00000132951 Chr15:101103149..101103351 TCTGCCCACTTTCGGATAAC Chr15:101103258..101103277 60.07 50
downstream ENSMUSE00000132953 Chr15:101103446..101103624 AGGCCTGAGCAGAAGATGAG Chr15:101103490..101103509 59.7 55
downstream ENSMUSE00000383435 Chr15:101104427..101105223 CGGAAGAGATCTCGAGTTGG Chr15:101105081..101105100 59.94 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGGAGCGTGTTTCTGTTT Chr15:101097416..101097436 60.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGAGCGTGTTTCTGTTT Chr15:101097416..101097436 60.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023034