Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24009
Trapped Gene
Eif2ak2 (ENSMUSG00000024079)
Vector Insertion
Chr 17: 79277614 - 79281739
Public Clones not available
Private Clones OST237816 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000465383 (Chr17:79281740..79281912 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACGGAGGGCGAATAGATTT Chr17:79281813..79281832 59.93 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000465383 (Chr17:79281740..79281912 -)
Downstram Exon
ENSMUSE00000138152 (Chr17:79277482..79277613 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACGGAGGGCGAATAGATTT Chr17:79281813..79281832 59.93 45 AATGGCTACTCCGTGCATCT Chr17:79277504..79277523 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000465383 Chr17:79281740..79281912 AACGGAGGGCGAATAGATTT Chr17:79281813..79281832 59.93 45

*** Putative Vector Insertion (Chr 17: 79277614 - 79281739) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138152 Chr17:79277482..79277613 AATGGCTACTCCGTGCATCT Chr17:79277504..79277523 59.72 50
downstream ENSMUSE00000138145 Chr17:79275522..79275642 CTAATTTGGCTGCAGCGTTT Chr17:79275529..79275548 60.4 45
downstream ENSMUSE00000138146 Chr17:79273283..79273419 GCACTCGTGTGACAATCCAC Chr17:79273378..79273397 60.17 55
downstream ENSMUSE00000256607 Chr17:79270489..79270609 TTTGGTGACACCTGAACCAG Chr17:79270527..79270546 59.56 50
downstream ENSMUSE00000256585 Chr17:79269994..79270073 TAGAGGATGTTCCGGCAGTT Chr17:79270030..79270049 59.69 50
downstream ENSMUSE00000256569 Chr17:79269827..79269875 GGAAAAACTTCCAGGTGCTG Chr17:79269823..79269842 59.71 50
downstream ENSMUSE00000256559 Chr17:79268816..79268850 No primer for this exon
downstream ENSMUSE00000138144 Chr17:79268097..79268147 TTGCACATCATCAGGGGATA Chr17:79268101..79268120 59.88 45
downstream ENSMUSE00000138156 Chr17:79265655..79265777 CCAAATCCACCTAAGCCAAT Chr17:79265705..79265724 58.9 45
downstream ENSMUSE00000138140 Chr17:79264642..79264761 AGTCAACTCCCTCCCAACAA Chr17:79264654..79264673 59.55 50
downstream ENSMUSE00000138149 Chr17:79263179..79263359 ACTCCGGTCACGATTTGTTC Chr17:79263200..79263219 59.97 50
downstream ENSMUSE00000138141 Chr17:79257841..79257972 TGTTCGGGATTTTCCATCAT Chr17:79257858..79257877 60.13 40
downstream ENSMUSE00000138143 Chr17:79255907..79256008 TTCTCTGACTCCGTGAAGCA Chr17:79255892..79255911 59.7 50
downstream ENSMUSE00000138150 Chr17:79254683..79254739 No primer for this exon
downstream ENSMUSE00000489155 Chr17:79251904..79254601 CCCAGAAATCCCCATATCCT Chr17:79252502..79252521 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGGAAAATAATCGCCTTG Chr17:79281677..79281697 59.68 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAAACGTGACTGGGAAAA Chr17:79281674..79281694 59.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024079