Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24011
Trapped Gene
Elovl5 (ENSMUSG00000032349)
Vector Insertion
Chr 9: 77829416 - 77830471
Public Clones not available
Private Clones OST237623 (lexicon) OST224992 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000218960 (Chr9:77829281..77829415 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTGACAATCATCCAGACG Chr9:77829291..77829310 60.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000218960 (Chr9:77829281..77829415 +)
Downstram Exon
ENSMUSE00000272557 (Chr9:77830472..77832323 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTGACAATCATCCAGACG Chr9:77829291..77829310 60.84 50 GTCAATCCTTTCGCTGCTTC Chr9:77830619..77830638 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000473563 Chr9:77765172..77765333 No primer for this exon
upstream ENSMUSE00000272620 Chr9:77804948..77805013 TCGATGCGTCACTCAGTACC Chr9:77804966..77804985 59.86 55
upstream ENSMUSE00000272601 Chr9:77808673..77808860 TGTATGGCTGGGACCAAAAT Chr9:77808749..77808768 60.19 45
upstream ENSMUSE00000272581 Chr9:77823592..77823669 CGGGAGAATCCGATATGAAG Chr9:77823650..77823669 59.48 50
upstream ENSMUSE00000218959 Chr9:77824555..77824726 TGTCTACCACCACGCTACCA Chr9:77824659..77824678 60.17 55
upstream ENSMUSE00000218961 Chr9:77827632..77827756 GTGCGACACTCAACAGCTTC Chr9:77827641..77827660 59.63 55
upstream ENSMUSE00000218960 Chr9:77829281..77829415 TGCTGACAATCATCCAGACG Chr9:77829291..77829310 60.84 50

*** Putative Vector Insertion (Chr 9: 77829416 - 77830471) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000272557 Chr9:77830472..77832323 GTCAATCCTTTCGCTGCTTC Chr9:77830619..77830638 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTCTGACCTTCGTCCTTT Chr9:77829437..77829457 60.77 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTCTGACCTTCGTCCTTT Chr9:77829437..77829457 60.77 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032349