Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24022
Trapped Gene
Dab2ip (ENSMUSG00000026883)
Vector Insertion
Chr 2: 35477804 - 35499407
Public Clones D173B05 (ggtc) D173B05 (ggtc) D127E12 (ggtc)
Private Clones OST237406 (lexicon) OST170197 (lexicon) OST77519 (lexicon) OST36859 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000645662 (Chr2:35477680..35477803 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTACTACTACCGGCTGCTG Chr2:35477722..35477742 59.55 57.14 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000645662 (Chr2:35477680..35477803 +)
Downstram Exon
ENSMUSE00000645669 (Chr2:35499408..35499511 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTACTACTACCGGCTGCTG Chr2:35477722..35477742 59.55 57.14 GGGGTTTTTCTCTGACATGC Chr2:35499475..35499494 59.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693906 Chr2:35414093..35414132 No primer for this exon
upstream ENSMUSE00000693848 Chr2:35436580..35436653 ACAACTCCGTGTGTGCAGAT Chr2:35436594..35436613 59.18 50
upstream ENSMUSE00000709561 Chr2:35477570..35477803 TCCTACTACTACCGGCTGCTG Chr2:35477722..35477742 59.55 57.14
upstream ENSMUSE00000719076 Chr2:35477570..35477803 TCCTACTACTACCGGCTGCTG Chr2:35477722..35477742 59.55 57.14
upstream ENSMUSE00000645662 Chr2:35477680..35477803 TCCTACTACTACCGGCTGCTG Chr2:35477722..35477742 59.55 57.14

*** Putative Vector Insertion (Chr 2: 35477804 - 35499407) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000645669 Chr2:35499408..35499511 GGGGTTTTTCTCTGACATGC Chr2:35499475..35499494 59.53 50
downstream ENSMUSE00000711722 Chr2:35499408..35499511 GGGGTTTTTCTCTGACATGC Chr2:35499475..35499494 59.53 50
downstream ENSMUSE00000714944 Chr2:35499408..35499511 GGGGTTTTTCTCTGACATGC Chr2:35499475..35499494 59.53 50
downstream ENSMUSE00000567506 Chr2:35517012..35517145 No primer for this exon
downstream ENSMUSE00000693841 Chr2:35517012..35517145 No primer for this exon
downstream ENSMUSE00000693836 Chr2:35517057..35517145 CTGTGGTTGCGGTCCAGTTT Chr2:35517088..35517107 63.4 55
downstream ENSMUSE00000712519 Chr2:35547514..35547930 CAAGGTTGTCACCGAGGAGT Chr2:35547806..35547825 60.15 55
downstream ENSMUSE00000719657 Chr2:35547514..35547930 CAAGGTTGTCACCGAGGAGT Chr2:35547806..35547825 60.15 55
downstream ENSMUSE00000693828 Chr2:35552252..35552327 CAGTCAGTCCAGCTCTGTGC Chr2:35552275..35552294 59.76 60
downstream ENSMUSE00000707384 Chr2:35563168..35563321 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60
downstream ENSMUSE00000709774 Chr2:35563168..35563321 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60
downstream ENSMUSE00000710455 Chr2:35563168..35563321 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60
downstream ENSMUSE00000711228 Chr2:35563168..35563321 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60
downstream ENSMUSE00000715485 Chr2:35563168..35563321 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60
downstream ENSMUSE00000693825 Chr2:35563720..35563876 GTTGCAACCCCAATGTTTTC Chr2:35563838..35563857 60.21 45
downstream ENSMUSE00000693827 Chr2:35563727..35563876 GTTGCAACCCCAATGTTTTC Chr2:35563838..35563857 60.21 45
downstream ENSMUSE00000603488 Chr2:35564334..35564432 CCTCAGGTTCTCCATCCACT Chr2:35564414..35564433 59.1 55
downstream ENSMUSE00000721356 Chr2:35564334..35564432 CCTCAGGTTCTCCATCCACT Chr2:35564414..35564433 59.1 55
downstream ENSMUSE00000721396 Chr2:35564334..35564432 CCTCAGGTTCTCCATCCACT Chr2:35564414..35564433 59.1 55
downstream ENSMUSE00000645656 Chr2:35565338..35565892 TTGAGCTTGCTTGTGGTACG Chr2:35565474..35565493 60.05 50
downstream ENSMUSE00000717523 Chr2:35565338..35565892 TTGAGCTTGCTTGTGGTACG Chr2:35565474..35565493 60.05 50
downstream ENSMUSE00000718572 Chr2:35565338..35565892 TTGAGCTTGCTTGTGGTACG Chr2:35565474..35565493 60.05 50
downstream ENSMUSE00000603491 Chr2:35568386..35568530 GTTCTCCCGGAAGATGAGGT Chr2:35568463..35568482 60.46 55
downstream ENSMUSE00000693898 Chr2:35568386..35568530 GTTCTCCCGGAAGATGAGGT Chr2:35568463..35568482 60.46 55
downstream ENSMUSE00000603490 Chr2:35568626..35568770 GCTTGGGTCCACTTCACAAT Chr2:35568684..35568703 59.97 50
downstream ENSMUSE00000693897 Chr2:35568626..35568770 GCTTGGGTCCACTTCACAAT Chr2:35568684..35568703 59.97 50
downstream ENSMUSE00000163861 Chr2:35570789..35571025 ATGAGGCGAACACCTCCTTA Chr2:35570829..35570848 59.69 50
downstream ENSMUSE00000693896 Chr2:35570789..35571025 ATGAGGCGAACACCTCCTTA Chr2:35570829..35570848 59.69 50
downstream ENSMUSE00000163860 Chr2:35572591..35572792 GCTGTGTTGGAAAGGGTCTC Chr2:35572710..35572729 59.7 55
downstream ENSMUSE00000693895 Chr2:35572591..35572792 GCTGTGTTGGAAAGGGTCTC Chr2:35572710..35572729 59.7 55
downstream ENSMUSE00000163862 Chr2:35574280..35574458 GGACATCCCTCAGGATACGA Chr2:35574331..35574350 59.89 55
downstream ENSMUSE00000693892 Chr2:35574280..35574458 GGACATCCCTCAGGATACGA Chr2:35574331..35574350 59.89 55
downstream ENSMUSE00000257703 Chr2:35575373..35576261 CGTGGGTACTGTAGGGTGCT Chr2:35576137..35576156 60.05 60
downstream ENSMUSE00000693890 Chr2:35575373..35576261 CGTGGGTACTGTAGGGTGCT Chr2:35576137..35576156 60.05 60
downstream ENSMUSE00000257694 Chr2:35576781..35576933 TTCTAACAACTGCGCGTTCA Chr2:35576861..35576880 60.58 45
downstream ENSMUSE00000693885 Chr2:35576781..35576933 TTCTAACAACTGCGCGTTCA Chr2:35576861..35576880 60.58 45
downstream ENSMUSE00000257688 Chr2:35578549..35578742 TCTTGGTGGAGATCCGTAGC Chr2:35578594..35578613 60.22 55
downstream ENSMUSE00000693879 Chr2:35578549..35578742 TCTTGGTGGAGATCCGTAGC Chr2:35578594..35578613 60.22 55
downstream ENSMUSE00000603489 Chr2:35582946..35583033 TGGAATCTACAGCTGCTTGC Chr2:35583013..35583032 59.18 50
downstream ENSMUSE00000693868 Chr2:35582946..35583033 TGGAATCTACAGCTGCTTGC Chr2:35583013..35583032 59.18 50
downstream ENSMUSE00000163853 Chr2:35583578..35586512 TCAACCGTGAGAGCAGTGTC Chr2:35585770..35585789 60.03 55
downstream ENSMUSE00000645664 Chr2:35583578..35583648 No primer for this exon
downstream ENSMUSE00000693823 Chr2:35583578..35586514 TCAACCGTGAGAGCAGTGTC Chr2:35585770..35585789 60.03 55
downstream ENSMUSE00000693853 Chr2:35583578..35583648 No primer for this exon
downstream ENSMUSE00000693860 Chr2:35583578..35586507 TCAACCGTGAGAGCAGTGTC Chr2:35585770..35585789 60.03 55
downstream ENSMUSE00000693866 Chr2:35583578..35586512 TCAACCGTGAGAGCAGTGTC Chr2:35585770..35585789 60.03 55
downstream ENSMUSE00000693835 Chr2:35584631..35586512 TCAACCGTGAGAGCAGTGTC Chr2:35585770..35585789 60.03 55
downstream ENSMUSE00000693839 Chr2:35584631..35584640 No primer for this exon
downstream ENSMUSE00000645663 Chr2:35585944..35586512 CGATCCAACCTTTGCATTTT Chr2:35586375..35586394 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:35486854..35486874 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTAGCCGTGACTGGGAAAA Chr2:35498849..35498869 60.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026883