Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24031
Trapped Gene
Ube2n (ENSMUSG00000074781)
Vector Insertion
Chr 10: 95004413 - 95004905
Public Clones not available
Private Clones OST237136 (lexicon) OST15957 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000640784 (Chr10:95004272..95004412 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAATGATGTAGCCGAGCAA Chr10:95004359..95004378 59.83 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000640784 (Chr10:95004272..95004412 +)
Downstram Exon
ENSMUSE00000640783 (Chr10:95004906..95008292 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAATGATGTAGCCGAGCAA Chr10:95004359..95004378 59.83 45 GCAGGAGGACTCAAAACTGC Chr10:95006138..95006157 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000640786 Chr10:95003783..95003815 No primer for this exon
upstream ENSMUSE00000640785 Chr10:95003839..95004085 CCAATGGCAGCACCTAAAGT Chr10:95003995..95004014 60.13 50
upstream ENSMUSE00000640784 Chr10:95004272..95004412 CAAATGATGTAGCCGAGCAA Chr10:95004359..95004378 59.83 45

*** Putative Vector Insertion (Chr 10: 95004413 - 95004905) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640783 Chr10:95004906..95008292 GCAGGAGGACTCAAAACTGC Chr10:95006138..95006157 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAGCCGAGCAATGGAAGAC Chr10:95004368..95004388 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAGCCGAGCAATGGAAGAC Chr10:95004368..95004388 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074781