Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2404
Trapped Gene
Ulk1 (ENSMUSG00000029512)
Vector Insertion
Chr 5: 111228176 - 111238023
Public Clones (sanger) AC0566 (sanger) (sanger) XT0270 (sanger) D056G04 (ggtc)
D052E02 (ggtc) D052E02 (ggtc) D056G04 (ggtc) (ggtc) D052E02 (ggtc)
D056G04 (ggtc) IST11825E7 (tigm) IST14459D12 (tigm) IST10227E10HMF1 (tigm)
IST12461B10 (tigm) IST12228H8 (tigm) IST11630F9 (tigm) IST12461B10 (tigm)
IST11764H3 (tigm) IST11728B12 (tigm) IST12277A7 (tigm) IST12228H8 (tigm)
IST10227E10 (tigm) IST11695D3 (tigm) IST11825E7 (tigm) IST12416D6 (tigm)
IST12416D6 (tigm) IST14872B9 (tigm) IST12777F1 (tigm) IST14872B9 (tigm)
IST14771G5 (tigm)
Private Clones OST181589 (lexicon) OST68170 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189694 (Chr5:111238024..111238065 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCGTGGCGCTGTATGACTT Chr5:111238028..111238047 60.69 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189694 (Chr5:111238024..111238065 -)
Downstram Exon
ENSMUSE00000189748 (Chr5:111228143..111228175 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCGTGGCGCTGTATGACTT Chr5:111238028..111238047 60.69 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000357368 Chr5:111238633..111239116 TGGGCAAGTTCGAGTTCTCT Chr5:111238693..111238712 59.99 50
upstream ENSMUSE00000189707 Chr5:111238146..111238238 CTTGCCAAGTCCCAAACACT Chr5:111238174..111238193 60.15 50
upstream ENSMUSE00000189694 Chr5:111238024..111238065 ATCGTGGCGCTGTATGACTT Chr5:111238028..111238047 60.69 50

*** Putative Vector Insertion (Chr 5: 111228176 - 111238023) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000189748 Chr5:111228143..111228175 No primer for this exon
downstream ENSMUSE00000406545 Chr5:111227901..111227937 GTGCAGGTAGTCAGCCAGGT Chr5:111227880..111227899 60.33 60
downstream ENSMUSE00000378719 Chr5:111225346..111225519 TCTTGACTCGGATGTTGCTG Chr5:111225327..111225346 59.98 50
downstream ENSMUSE00000189712 Chr5:111225175..111225248 TACCGAGCGAATCCAAAGTC Chr5:111225205..111225224 60.21 50
downstream ENSMUSE00000391857 Chr5:111224751..111224852 GGTCAGCCTTTCCATCGTAG Chr5:111224785..111224804 59.69 55
downstream ENSMUSE00000350353 Chr5:111223766..111223824 CATAAAACAGGCGCAAATCC Chr5:111223769..111223788 60.46 45
downstream ENSMUSE00000189716 Chr5:111223604..111223686 AAAGTCCATGCGGTCCTTGT Chr5:111223583..111223602 61.84 50
downstream ENSMUSE00000189702 Chr5:111223212..111223262 AAGGGTGGTGGAAAAATTCA Chr5:111223220..111223239 59.26 40
downstream ENSMUSE00000189708 Chr5:111222834..111222922 CCCTGAGCTTGGATATGAGG Chr5:111222863..111222882 59.65 55
downstream ENSMUSE00000189720 Chr5:111221985..111222132 GGGGAGGTAAGGGTCTTCTG Chr5:111222067..111222086 59.93 60
downstream ENSMUSE00000189719 Chr5:111221416..111221476 ACACAGCAGGCTATCAGGTG Chr5:111221399..111221418 58.91 55
downstream ENSMUSE00000189714 Chr5:111221121..111221210 No primer for this exon
downstream ENSMUSE00000189718 Chr5:111220620..111220745 GCTGGTAATTGTGCACCTGA Chr5:111220644..111220663 59.72 50
downstream ENSMUSE00000189731 Chr5:111220071..111220216 TTGGGGAGAAGGTGTGTAGG Chr5:111220050..111220069 59.96 55
downstream ENSMUSE00000189744 Chr5:111219869..111219955 No primer for this exon
downstream ENSMUSE00000691628 Chr5:111219869..111219973 No primer for this exon
downstream ENSMUSE00000189717 Chr5:111219231..111219499 TGGAAGTCGGACAGGTTAGG Chr5:111219396..111219415 60.1 55
downstream ENSMUSE00000189729 Chr5:111218361..111218554 GGTCAGGCAGTGTACGGTTC Chr5:111218421..111218440 60.58 60
downstream ENSMUSE00000189695 Chr5:111217967..111218076 GAGTCCCAAATGCAGCCTTA Chr5:111217999..111218018 60.21 50
downstream ENSMUSE00000189705 Chr5:111217748..111217891 GATGCAGAGTCCCTCCAAAG Chr5:111217837..111217856 59.8 55
downstream ENSMUSE00000189741 Chr5:111217129..111217319 GGTCAGCAAGGCTACAGCAG Chr5:111217178..111217197 61.14 60
downstream ENSMUSE00000189691 Chr5:111216792..111216964 GTGTAGGGTTTCCGTGTGCT Chr5:111216919..111216938 60.03 55
downstream ENSMUSE00000189724 Chr5:111216593..111216711 CCAGCTCGAATCTGGTCAAT Chr5:111216603..111216622 60.22 50
downstream ENSMUSE00000189700 Chr5:111216103..111216260 CCAGAAAGAAGCGCTGAAGT Chr5:111216155..111216174 59.76 50
downstream ENSMUSE00000189698 Chr5:111215319..111215454 CAGCAATAGCAGGGCTTTGT Chr5:111215352..111215371 60.41 50
downstream ENSMUSE00000295761 Chr5:111213507..111215246 TGCTGGCTAGGTTCTCCAGT Chr5:111214645..111214664 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGGAGGGGTAAATCTATTC Chr5:111234980..111235001 59.87 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGGAGGGGTAAATCTATTC Chr5:111234980..111235001 59.87 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCGCTGTATGACTTCCAGGT Chr5:111235020..111235040 60.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCGCTGTATGACTTCCAGGT Chr5:111235020..111235040 60.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029512