Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24059
Trapped Gene
Aqp11 (ENSMUSG00000042797)
Vector Insertion
Chr 7: 104875215 - 104877480
Public Clones not available
Private Clones OST236323 (lexicon) OST6495 (lexicon)
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000388766 (Chr7:104877481..104877597 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGTGCTTTGACGAACTCTT Chr7:104877522..104877541 60.43 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000388766 (Chr7:104877481..104877597 -)
Downstram Exon
ENSMUSE00000343233 (Chr7:104874889..104875214 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGTGCTTTGACGAACTCTT Chr7:104877522..104877541 60.43 50 GTTCGAGTCTTTGGGAGTGG Chr7:104875093..104875112 59.7 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346173 Chr7:104885879..104886497 TAGCTTGCAGGAATCCCATC Chr7:104886021..104886040 60.18 50
upstream ENSMUSE00000388766 Chr7:104877481..104877597 CCGTGCTTTGACGAACTCTT Chr7:104877522..104877541 60.43 50

*** Putative Vector Insertion (Chr 7: 104875215 - 104877480) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000343233 Chr7:104874889..104875214 GTTCGAGTCTTTGGGAGTGG Chr7:104875093..104875112 59.7 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAACCTAATCGCCTTGCAG Chr7:104877415..104877435 59.36 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTGCTCCTTCTGTAGGTAA Chr7:104877475..104877497 59.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042797