Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24079
Trapped Gene
Kctd21 (ENSMUSG00000044952)
Vector Insertion
Chr 7: 104480882 - 104495802
Public Clones (ggtc) (cmhd) IST14251G7 (tigm) IST14635G8 (tigm)
Private Clones OST235598 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000590653 (Chr7:104480837..104480881 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000590653 (Chr7:104480837..104480881 +)
Downstram Exon
ENSMUSE00000366767 (Chr7:104495803..104498719 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGAACAAAGCGAAGCCGTAA Chr7:104497843..104497862 60.02 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000590653 Chr7:104480837..104480881 No primer for this exon

*** Putative Vector Insertion (Chr 7: 104480882 - 104495802) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000366767 Chr7:104495803..104498719 AGAACAAAGCGAAGCCGTAA Chr7:104497843..104497862 60.02 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAATGTAATCGCCTTGCAG Chr7:104489927..104489947 59.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTCCAGATTGCCCTTCTC Chr7:104489877..104489897 58.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044952