Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24097
Trapped Gene
Tbc1d25 (ENSMUSG00000039201)
Vector Insertion
Chr X: 7733631 - 7733776
Public Clones not available
Private Clones OST234796 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000240087 (ChrX:7733777..7733904 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGGCTGAGAAGCGATCAT ChrX:7733824..7733843 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000240087 (ChrX:7733777..7733904 -)
Downstram Exon
ENSMUSE00000240081 (ChrX:7733442..7733630 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGGCTGAGAAGCGATCAT ChrX:7733824..7733843 59.98 50 GGTACGTGTGGAACTCAGCA ChrX:7733503..7733522 59.75 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000408475 ChrX:7752837..7753307 TCTCTCAAGCTCGTCCGTTT ChrX:7753285..7753304 60.13 50
upstream ENSMUSE00000368344 ChrX:7751327..7751436 CTCATCCGAGCCTTTGACTT ChrX:7751333..7751352 59.43 50
upstream ENSMUSE00000240093 ChrX:7749864..7750018 ACCGGCTAGGACAGGAAACT ChrX:7749964..7749983 60.13 55
upstream ENSMUSE00000240087 ChrX:7733777..7733904 ACTGGCTGAGAAGCGATCAT ChrX:7733824..7733843 59.98 50

*** Putative Vector Insertion (Chr X: 7733631 - 7733776) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000240081 ChrX:7733442..7733630 GGTACGTGTGGAACTCAGCA ChrX:7733503..7733522 59.75 55
downstream ENSMUSE00000383997 ChrX:7731605..7733192 CTGCTCGTACTCTCGGCTCT ChrX:7733075..7733094 59.91 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000039201