Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24098
Trapped Gene
Rreb1 (ENSMUSG00000039087)
Vector Insertion
Chr 13: 37980842 - 37984420
Public Clones not available
Private Clones OST234778 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000616470 (Chr13:37980740..37980841 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGGCAGAACGAAGAAAAC Chr13:37980820..37980839 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000616470 (Chr13:37980740..37980841 +)
Downstram Exon
ENSMUSE00000616469 (Chr13:37984421..37984527 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGGCAGAACGAAGAAAAC Chr13:37980820..37980839 59.99 50 TCTGCCCCAAATGATAGTCC Chr13:37984522..37984541 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683176 Chr13:37917908..37918213 CCTCCCTATGGGAGAAGAGG Chr13:37918037..37918056 60.02 60
upstream ENSMUSE00000683166 Chr13:37918801..37918844 No primer for this exon
upstream ENSMUSE00000683167 Chr13:37919262..37919600 GCTTCGCTTTTTCCTCACAC Chr13:37919311..37919330 60 50
upstream ENSMUSE00000642497 Chr13:37980303..37980549 GGTGTTTATGGTGCCGAAGT Chr13:37980349..37980368 59.86 50
upstream ENSMUSE00000616470 Chr13:37980740..37980841 CTCGGCAGAACGAAGAAAAC Chr13:37980820..37980839 59.99 50

*** Putative Vector Insertion (Chr 13: 37980842 - 37984420) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000616469 Chr13:37984421..37984527 TCTGCCCCAAATGATAGTCC Chr13:37984522..37984541 59.89 50
downstream ENSMUSE00000292709 Chr13:37985641..37987067 CTATGAAGCAACCGAGCACA Chr13:37986359..37986378 60.01 50
downstream ENSMUSE00000683165 Chr13:37985641..37986094 AGGGTGTCCCTTTAGGCAGT Chr13:37985949..37985968 59.99 55
downstream ENSMUSE00000683175 Chr13:37985641..37985853 CTCTGTGACACTCGCTACGC Chr13:37985781..37985800 59.8 60
downstream ENSMUSE00000616467 Chr13:37985743..37985853 TGACACTCGCTACGCTCATT Chr13:37985776..37985795 59.62 50
downstream ENSMUSE00000642478 Chr13:37990281..37990370 CTGGGTGGTGCAAATCTTTT Chr13:37990346..37990365 59.97 45
downstream ENSMUSE00000642493 Chr13:37990281..37990370 CTGGGTGGTGCAAATCTTTT Chr13:37990346..37990365 59.97 45
downstream ENSMUSE00000292696 Chr13:37991493..37991656 CCCATTGGTGGTGAAAGACT Chr13:37991648..37991667 59.82 50
downstream ENSMUSE00000292693 Chr13:38007891..38008029 GTCTTCTGACTCGGCATCGT Chr13:38008014..38008033 60.42 55
downstream ENSMUSE00000292689 Chr13:38008328..38008464 CCTGACTGCCCGTCTTCTAC Chr13:38008353..38008372 59.87 60
downstream ENSMUSE00000292685 Chr13:38019992..38020181 GGAATCGAAGGGTTGTTCTG Chr13:38020120..38020139 59.53 50
downstream ENSMUSE00000292681 Chr13:38021427..38024358 GGATGCGTAGAGCTCGGTAG Chr13:38022843..38022862 60 60
downstream ENSMUSE00000683168 Chr13:38021427..38027401 GGATGCGTAGAGCTCGGTAG Chr13:38022843..38022862 60 60
downstream ENSMUSE00000616466 Chr13:38033412..38033573 TGCTATCATGGGATCCAACA Chr13:38033573..38033592 59.88 45
downstream ENSMUSE00000616465 Chr13:38038726..38039532 GTGCTCTCTTCCACACGACA Chr13:38038957..38038976 60.03 55
downstream ENSMUSE00000541099 Chr13:38040512..38043863 GTTCGCTCACAGGTCTGACA Chr13:38040551..38040570 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCGTAGGCTTCCTTGAGT Chr13:37980853..37980873 59.64 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCGTAGGCTTCCTTGAGT Chr13:37980853..37980873 59.64 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039087