Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24102
Trapped Gene
OTTMUSG00000016546 (ENSMUSG00000078905)
Vector Insertion
Chr 2: 174889162 - 174889368
Public Clones not available
Private Clones OST234623 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678927 (Chr2:174889369..174889495 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCATGTCAACTTCACTCAGG Chr2:174889453..174889473 59.89 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678927 (Chr2:174889369..174889495 -)
Downstram Exon
ENSMUSE00000678926 (Chr2:174889101..174889161 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCATGTCAACTTCACTCAGG Chr2:174889453..174889473 59.89 47.62 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678924 Chr2:174893201..174893282 AATGTGTTTTGAGCGCCTCT Chr2:174893247..174893266 59.88 45
upstream ENSMUSE00000714617 Chr2:174893201..174893264 TTGAGCGCCTCTACTGAGTG Chr2:174893239..174893258 59.34 55
upstream ENSMUSE00000678927 Chr2:174889369..174889495 TGCATGTCAACTTCACTCAGG Chr2:174889453..174889473 59.89 47.62

*** Putative Vector Insertion (Chr 2: 174889162 - 174889368) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678926 Chr2:174889101..174889161 No primer for this exon
downstream ENSMUSE00000678923 Chr2:174888807..174889161 GCATGGCTCTACTAGGCTTGA Chr2:174888825..174888845 59.63 52.38
downstream ENSMUSE00000709461 Chr2:174887050..174887422 AACTCAGAGGGTTGCTCTGC Chr2:174887362..174887381 59.6 55
downstream ENSMUSE00000719886 Chr2:174887050..174887422 AACTCAGAGGGTTGCTCTGC Chr2:174887362..174887381 59.6 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:174889297..174889317 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000078905