Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24108
Trapped Gene
Pus10 (ENSMUSG00000020280)
Vector Insertion
Chr 11: 23599965 - 23602889
Public Clones not available
Private Clones OST234343 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000103007 (Chr11:23599930..23599964 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000103007 (Chr11:23599930..23599964 +)
Downstram Exon
ENSMUSE00000103020 (Chr11:23602890..23603001 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000270458 Chr11:23565674..23565748 No primer for this exon
upstream ENSMUSE00000409128 Chr11:23565976..23566453 No primer for this exon
upstream ENSMUSE00000103012 Chr11:23567278..23567414 No primer for this exon
upstream ENSMUSE00000680625 Chr11:23567288..23567414 No primer for this exon
upstream ENSMUSE00000103029 Chr11:23572508..23572756 No primer for this exon
upstream ENSMUSE00000103014 Chr11:23573238..23573324 No primer for this exon
upstream ENSMUSE00000103007 Chr11:23599930..23599964 No primer for this exon

*** Putative Vector Insertion (Chr 11: 23599965 - 23602889) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000103020 Chr11:23602890..23603001 No primer for this exon
downstream ENSMUSE00000270418 Chr11:23606885..23606946 No primer for this exon
downstream ENSMUSE00000103009 Chr11:23607523..23607568 No primer for this exon
downstream ENSMUSE00000103002 Chr11:23608758..23608822 No primer for this exon
downstream ENSMUSE00000270405 Chr11:23611196..23611281 No primer for this exon
downstream ENSMUSE00000270399 Chr11:23612200..23612325 No primer for this exon
downstream ENSMUSE00000103028 Chr11:23617562..23617618 No primer for this exon
downstream ENSMUSE00000103026 Chr11:23618576..23618652 No primer for this exon
downstream ENSMUSE00000103038 Chr11:23618749..23618804 No primer for this exon
downstream ENSMUSE00000103033 Chr11:23620104..23620221 No primer for this exon
downstream ENSMUSE00000103023 Chr11:23625432..23625574 No primer for this exon
downstream ENSMUSE00000103022 Chr11:23628975..23629074 No primer for this exon
downstream ENSMUSE00000349081 Chr11:23631321..23632876 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCATGGTTGCTGGTAAAA Chr11:23599935..23599955 59.73 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCATGGTTGCTGGTAAAA Chr11:23599935..23599955 59.73 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020280