Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24119
Trapped Gene
Pcgf2 (ENSMUSG00000018537)
Vector Insertion
Chr 11: 97553450 - 97553682
Public Clones not available
Private Clones OST234010 (lexicon) OST216212 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673727 (Chr11:97553683..97553721 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673727 (Chr11:97553683..97553721 -)
Downstram Exon
ENSMUSE00000661404 (Chr11:97553341..97553449 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000339180 Chr11:97561574..97561660 No primer for this exon
upstream ENSMUSE00000378146 Chr11:97560850..97560962 No primer for this exon
upstream ENSMUSE00000661403 Chr11:97560850..97560955 No primer for this exon
upstream ENSMUSE00000285742 Chr11:97560520..97560614 No primer for this exon
upstream ENSMUSE00000285732 Chr11:97559303..97559374 No primer for this exon
upstream ENSMUSE00000285720 Chr11:97554730..97554882 No primer for this exon
upstream ENSMUSE00000715631 Chr11:97554730..97554882 No primer for this exon
upstream ENSMUSE00000111125 Chr11:97554040..97554136 No primer for this exon
upstream ENSMUSE00000111119 Chr11:97553818..97553873 No primer for this exon
upstream ENSMUSE00000111122 Chr11:97553683..97553733 No primer for this exon
upstream ENSMUSE00000673727 Chr11:97553683..97553721 No primer for this exon

*** Putative Vector Insertion (Chr 11: 97553450 - 97553682) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000111116 Chr11:97553359..97553449 No primer for this exon
downstream ENSMUSE00000661404 Chr11:97553341..97553449 No primer for this exon
downstream ENSMUSE00000111117 Chr11:97553172..97553226 No primer for this exon
downstream ENSMUSE00000111120 Chr11:97552998..97553093 No primer for this exon
downstream ENSMUSE00000673726 Chr11:97552998..97553036 No primer for this exon
downstream ENSMUSE00000111121 Chr11:97552275..97552355 No primer for this exon
downstream ENSMUSE00000673728 Chr11:97551139..97551672 No primer for this exon
downstream ENSMUSE00000399653 Chr11:97551134..97551672 No primer for this exon
downstream ENSMUSE00000673725 Chr11:97551106..97551672 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACTCTGAACCCACAAGCA Chr11:97553649..97553669 60.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACTCTGAACCCACAAGCA Chr11:97553649..97553669 60.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018537