Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24121
Trapped Gene
E130308A19Rik (ENSMUSG00000045071)
Vector Insertion
Chr 4: 59639364 - 59703015
Public Clones IST14633G10 (tigm) IST14673A3 (tigm)
Private Clones OST234007 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000632492 (Chr4:59639083..59639363 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTATGGACAGACGCACAG Chr4:59639334..59639353 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000632492 (Chr4:59639083..59639363 +)
Downstram Exon
ENSMUSE00000339543 (Chr4:59703016..59704210 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTATGGACAGACGCACAG Chr4:59639334..59639353 59.85 55 GTGTCAATGAAAGGGCTGGT Chr4:59703736..59703755 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000632492 Chr4:59639083..59639363 TCCTATGGACAGACGCACAG Chr4:59639334..59639353 59.85 55
upstream ENSMUSE00000632491 Chr4:59639199..59639363 TCCTATGGACAGACGCACAG Chr4:59639334..59639353 59.85 55

*** Putative Vector Insertion (Chr 4: 59639364 - 59703015) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000339543 Chr4:59703016..59704210 GTGTCAATGAAAGGGCTGGT Chr4:59703736..59703755 59.97 50
downstream ENSMUSE00000376289 Chr4:59732513..59733555 GCTCAGGTTGTTGCAGATGA Chr4:59733471..59733490 59.99 50
downstream ENSMUSE00000454238 Chr4:59750434..59750606 CGTTGGTCATGCACCAGTAG Chr4:59750580..59750599 60.17 55
downstream ENSMUSE00000604186 Chr4:59765105..59767175 GGAAGTCTGAGCCGTCACTC Chr4:59765183..59765202 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTGAGTCATCATGGTCTG Chr4:59675375..59675395 59.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTGAGTCATCATGGTCTG Chr4:59675375..59675395 59.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045071