Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24130
Trapped Gene
Atg2a (ENSMUSG00000024773)
Vector Insertion
Chr 19: 6241967 - 6244426
Public Clones (sanger) (sanger)
Private Clones OST233536 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000468095 (Chr19:6241668..6241966 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGTGAAAGAGCGTGTCTGC Chr19:6241827..6241846 59.63 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000468095 (Chr19:6241668..6241966 +)
Downstram Exon
ENSMUSE00000471193 (Chr19:6244427..6244589 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGTGAAAGAGCGTGTCTGC Chr19:6241827..6241846 59.63 55 TAAGCTGAAGGCCTGACACA Chr19:6244568..6244587 59.59 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000468095 Chr19:6241668..6241966 GTGTGAAAGAGCGTGTCTGC Chr19:6241827..6241846 59.63 55

*** Putative Vector Insertion (Chr 19: 6241967 - 6244426) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471193 Chr19:6244427..6244589 TAAGCTGAAGGCCTGACACA Chr19:6244568..6244587 59.59 50
downstream ENSMUSE00000470176 Chr19:6244687..6244839 TGTGGTGGTTCTGAGGGTTC Chr19:6244798..6244817 60.97 55
downstream ENSMUSE00000472274 Chr19:6245046..6245148 AGCCACACTTCGATCCTCAT Chr19:6245131..6245150 59.69 50
downstream ENSMUSE00000341878 Chr19:6245459..6245693 GAGGGCAGCTCCTCAAAGTA Chr19:6245593..6245612 59.57 55
downstream ENSMUSE00000245386 Chr19:6246304..6246400 CCAGTTGTCCTGATACCTCCA Chr19:6246327..6246347 59.97 52.38
downstream ENSMUSE00000245213 Chr19:6246488..6246649 AGTGGACGGCTCTTGTTCAG Chr19:6246533..6246552 60.44 55
downstream ENSMUSE00000245182 Chr19:6246752..6246892 AGACAGCCGATGTCACACTG Chr19:6246805..6246824 59.9 55
downstream ENSMUSE00000245155 Chr19:6247639..6247876 CAGCATCGAACTCAGCAAAA Chr19:6247797..6247816 60.13 45
downstream ENSMUSE00000245124 Chr19:6247963..6248110 CATAGGCACTCCAGCACCTC Chr19:6248079..6248098 60.82 60
downstream ENSMUSE00000245097 Chr19:6248197..6248289 GAGTGACTGGGGAAGCTCAG Chr19:6248222..6248241 59.99 60
downstream ENSMUSE00000245064 Chr19:6249772..6249927 TGGTGACTTGACGGAACAAG Chr19:6249901..6249920 59.72 50
downstream ENSMUSE00000245031 Chr19:6250024..6250267 GTAAGTTCCAGGCGGGTAGG Chr19:6250253..6250272 60.87 60
downstream ENSMUSE00000245000 Chr19:6250413..6250509 TACTTGGCCTCAGTGCTCCT Chr19:6250500..6250519 60.01 55
downstream ENSMUSE00000244978 Chr19:6250596..6250755 TGCTGTAGCTCACACGGACT Chr19:6250706..6250725 59.65 55
downstream ENSMUSE00000244963 Chr19:6251259..6251401 CCAGAGTACAGCGGGACAGT Chr19:6251337..6251356 60.32 60
downstream ENSMUSE00000244946 Chr19:6251488..6251603 TTGAAGGCTGACTTGCACAT Chr19:6251601..6251620 59.44 45
downstream ENSMUSE00000244928 Chr19:6251706..6251863 ATGCCATCGAGAAGAACTGG Chr19:6251753..6251772 60.22 50
downstream ENSMUSE00000244920 Chr19:6252427..6252577 GGTACTGGGCTACGCTGAAG Chr19:6252517..6252536 59.9 60
downstream ENSMUSE00000519567 Chr19:6252690..6252883 GTCCAGGTGGATACGGACAG Chr19:6252868..6252887 60.39 60
downstream ENSMUSE00000244890 Chr19:6252988..6253068 CAGCCGTACTGTCACCAAAA Chr19:6253014..6253033 59.76 50
downstream ENSMUSE00000244878 Chr19:6253334..6253440 CAGGACAGTGATGACGGTTG Chr19:6253408..6253427 60.15 55
downstream ENSMUSE00000244862 Chr19:6253524..6253616 GAGGGTGAAGGTCTCAGCAG Chr19:6253578..6253597 59.99 60
downstream ENSMUSE00000244824 Chr19:6254359..6254429 ACAGAGCGGAGTCATCAAGG Chr19:6254387..6254406 60.41 55
downstream ENSMUSE00000244795 Chr19:6254590..6254666 CCCTTCCAGGTTTTGATGAC Chr19:6254650..6254669 59.38 50
downstream ENSMUSE00000417223 Chr19:6255101..6255265 CCCGAGCTGGTTAGGTACTG Chr19:6255213..6255232 59.75 60
downstream ENSMUSE00000421446 Chr19:6255409..6255538 TATCCAGAAGGGCGTCAGTC Chr19:6255502..6255521 60.22 55
downstream ENSMUSE00000421440 Chr19:6255619..6255827 ATAGACGGAGACGGGAGAGG Chr19:6255659..6255678 60.61 60
downstream ENSMUSE00000144884 Chr19:6256168..6256376 GTAGTACCACACGGCTGCTG Chr19:6256315..6256334 59.39 60
downstream ENSMUSE00000144879 Chr19:6256552..6256687 CCTGTGAGGCCTACTCTTGC Chr19:6256575..6256594 60.01 60
downstream ENSMUSE00000144890 Chr19:6257439..6257642 CAGCTATGGCCGACTCTTCT Chr19:6257487..6257506 59.6 55
downstream ENSMUSE00000144878 Chr19:6257777..6257878 AGGCATCATGGAGACTCGAA Chr19:6257860..6257879 60.77 50
downstream ENSMUSE00000144888 Chr19:6257963..6258044 GGACCATGGGGTTGATACTG Chr19:6258029..6258048 60.05 55
downstream ENSMUSE00000353038 Chr19:6258134..6258266 GATAGGCTGCTGGTCAGAGG Chr19:6258261..6258280 59.97 60
downstream ENSMUSE00000244604 Chr19:6258361..6258433 ATGGTAATCCAGGCAGATGG Chr19:6258409..6258428 59.77 50
downstream ENSMUSE00000144886 Chr19:6258551..6258633 CAGCAGAGCCTCTTGAGCTT Chr19:6258627..6258646 60.03 55
downstream ENSMUSE00000144889 Chr19:6258864..6258985 TCATTGAGGGCATAGCACAG Chr19:6258908..6258927 59.82 50
downstream ENSMUSE00000245607 Chr19:6259989..6260143 CTGTGGATGACCCAAAGGAG Chr19:6260099..6260118 60.5 55
downstream ENSMUSE00000421388 Chr19:6261372..6261524 CTTGTAGGGATCGGGAGACA Chr19:6261438..6261457 60.06 55
downstream ENSMUSE00000245575 Chr19:6261601..6262304 CTTCACAGTGGCCATCCTTT Chr19:6261984..6262003 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr19:6242017..6242037 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGAAACCTGGGTGAGGAG Chr19:6241956..6241976 61.99 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024773