Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24150
Trapped Gene
Sgol1 (ENSMUSG00000023940)
Vector Insertion
Chr 17: 53826606 - 53827035
Public Clones IST11041A8 (tigm)
Private Clones OST232759 (lexicon) OST216697 (lexicon) OST57730 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000501452 (Chr17:53827036..53827183 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATAAAAATTTGGCGGGGATT Chr17:53827079..53827098 59.53 35 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000501452 (Chr17:53827036..53827183 -)
Downstram Exon
ENSMUSE00000136522 (Chr17:53826409..53826605 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATAAAAATTTGGCGGGGATT Chr17:53827079..53827098 59.53 35 TTTCTCAGTTGCAGGATGACA Chr17:53826466..53826486 59.43 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000345240 Chr17:53828536..53828658 AACGCAGAATTTCGAATGTG Chr17:53828604..53828623 58.77 40
upstream ENSMUSE00000388704 Chr17:53827315..53827445 TATGACCCACCTGCCTTAGC Chr17:53827394..53827413 60.1 55
upstream ENSMUSE00000501452 Chr17:53827036..53827183 ATAAAAATTTGGCGGGGATT Chr17:53827079..53827098 59.53 35

*** Putative Vector Insertion (Chr 17: 53826606 - 53827035) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136522 Chr17:53826409..53826605 TTTCTCAGTTGCAGGATGACA Chr17:53826466..53826486 59.43 42.86
downstream ENSMUSE00000136524 Chr17:53822879..53822955 TTGTCAATGCTGGAGACCAC Chr17:53822890..53822909 59.68 50
downstream ENSMUSE00000136526 Chr17:53820770..53820813 No primer for this exon
downstream ENSMUSE00000136528 Chr17:53818235..53819026 AAATCGCAACCCTGTGTCTC Chr17:53818962..53818981 60.12 50
downstream ENSMUSE00000136519 Chr17:53816232..53816421 TGGTGCTACACCTGCGTTTA Chr17:53816241..53816260 60.32 50
downstream ENSMUSE00000136521 Chr17:53815381..53816036 AGAAGGGATCCTCACCCACT Chr17:53815605..53815624 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGAAACGCAAGTCCTTTA Chr17:53827058..53827078 60.61 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGAAACGCAAGTCCTTTA Chr17:53827058..53827078 60.61 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAGATACCCTAATCGCCTTGC Chr17:53827121..53827142 59.61 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTTCAAGATACCCCGTGACTG Chr17:53827125..53827146 59.98 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023940