Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24152
Trapped Gene
Ern1 (ENSMUSG00000020715)
Vector Insertion
Chr 11: 106320221 - 106320343
Public Clones (egtc)
Private Clones OST232746 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108491 (Chr11:106320222..106320342 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108491 (Chr11:106320222..106320342 -)
Downstram Exon
ENSMUSE00000671184 (Chr11:106319870..106320342 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362771 Chr11:106348931..106349110 No primer for this exon
upstream ENSMUSE00000671185 Chr11:106348931..106349117 No primer for this exon
upstream ENSMUSE00000671187 Chr11:106348931..106349122 No primer for this exon
upstream ENSMUSE00000671190 Chr11:106348931..106349150 No primer for this exon
upstream ENSMUSE00000108491 Chr11:106320222..106320342 No primer for this exon

*** Putative Vector Insertion (Chr 11: 106320221 - 106320343) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000671184 Chr11:106319870..106320342 No primer for this exon
downstream ENSMUSE00000108481 Chr11:106298404..106298437 No primer for this exon
downstream ENSMUSE00000108489 Chr11:106296229..106296301 No primer for this exon
downstream ENSMUSE00000671186 Chr11:106295995..106296301 No primer for this exon
downstream ENSMUSE00000108488 Chr11:106290328..106290400 No primer for this exon
downstream ENSMUSE00000108476 Chr11:106288127..106288249 No primer for this exon
downstream ENSMUSE00000108473 Chr11:106284701..106284802 No primer for this exon
downstream ENSMUSE00000108483 Chr11:106283020..106283281 No primer for this exon
downstream ENSMUSE00000108480 Chr11:106281333..106281411 No primer for this exon
downstream ENSMUSE00000108471 Chr11:106280138..106280303 No primer for this exon
downstream ENSMUSE00000108467 Chr11:106275665..106275783 No primer for this exon
downstream ENSMUSE00000671189 Chr11:106275080..106275783 No primer for this exon
downstream ENSMUSE00000108482 Chr11:106272937..106273128 No primer for this exon
downstream ENSMUSE00000108485 Chr11:106271209..106271476 No primer for this exon
downstream ENSMUSE00000108466 Chr11:106270204..106270294 No primer for this exon
downstream ENSMUSE00000108475 Chr11:106269374..106269563 No primer for this exon
downstream ENSMUSE00000108470 Chr11:106268810..106268909 No primer for this exon
downstream ENSMUSE00000108478 Chr11:106268355..106268554 No primer for this exon
downstream ENSMUSE00000108487 Chr11:106267036..106267183 No primer for this exon
downstream ENSMUSE00000108469 Chr11:106264762..106264889 No primer for this exon
downstream ENSMUSE00000108479 Chr11:106261509..106261632 No primer for this exon
downstream ENSMUSE00000108486 Chr11:106261086..106261153 No primer for this exon
downstream ENSMUSE00000108474 Chr11:106258934..106260068 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGGTGAAGGAGTGGATTG Chr11:106320368..106320388 60.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGTGAAGGAGTGGATTG Chr11:106320368..106320388 60.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020715