Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2416
Trapped Gene
AK122525 (ENSMUSG00000038214)
Vector Insertion
Chr 10: 43214149 - 43229652
Public Clones (sanger) AC0496 (sanger) (sanger) (sanger) AD0373 (sanger) (sanger)
D112H01 (ggtc) IST13217D7 (tigm) IST14378C6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000458897 (Chr10:43213952..43214148 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGCTACCTTGGACTGCTC Chr10:43213987..43214006 60.02 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000458897 (Chr10:43213952..43214148 +)
Downstram Exon
ENSMUSE00000508545 (Chr10:43229653..43233622 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGCTACCTTGGACTGCTC Chr10:43213987..43214006 60.02 60 CGCTACTGGAGTTTGCCTTC Chr10:43229905..43229924 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000496671 Chr10:43198946..43199178 CGCTCCGCAAAGTAACAACT Chr10:43199149..43199168 60.44 50
upstream ENSMUSE00000497694 Chr10:43213448..43213495 No primer for this exon
upstream ENSMUSE00000458897 Chr10:43213952..43214148 GACGCTACCTTGGACTGCTC Chr10:43213987..43214006 60.02 60

*** Putative Vector Insertion (Chr 10: 43214149 - 43229652) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000508545 Chr10:43229653..43233622 CGCTACTGGAGTTTGCCTTC Chr10:43229905..43229924 60.01 55
downstream ENSMUSE00000511401 Chr10:43233769..43235202 ACGGCCACATGAATAAAAGC Chr10:43234566..43234585 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTTTGCTCCATGGACTCTG Chr10:43229164..43229185 59.3 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCTCCCTTTCTGGCAAAT Chr10:43229178..43229198 60.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038214