Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24174
Trapped Gene
Hic2 (ENSMUSG00000050240)
Vector Insertion
Chr 16: 17257427 - 17260765
Public Clones not available
Private Clones OST232216 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000562482 (Chr16:17257428..17263522 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCACAGATGCTTCACTTCC Chr16:17260398..17260417 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000562482 (Chr16:17257428..17263522 +)
Downstram Exon
ENSMUSE00000703890 (Chr16:17260688..17260764 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCACAGATGCTTCACTTCC Chr16:17260398..17260417 59.99 50 ACCTCTGGCTCTGCTGTAGG Chr16:17260765..17260784 59.62 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000427983 Chr16:17233680..17233823 No primer for this exon
upstream ENSMUSE00000427974 Chr16:17255061..17255159 TTGATGCACCCTCAGGAAGT Chr16:17255072..17255091 60.66 50

*** Putative Vector Insertion (Chr 16: 17257427 - 17260765) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000562482 Chr16:17257428..17263522 GACGGAGTCCACTGAGCTTC Chr16:17262171..17262190 59.99 60
downstream ENSMUSE00000703891 Chr16:17257428..17259025 CCACTACTCCCATTGGTGCT Chr16:17258117..17258136 59.99 55
downstream ENSMUSE00000703890 Chr16:17260688..17260764 ACCTCTGGCTCTGCTGTAGG Chr16:17260765..17260784 59.62 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTTCACTTCCTTGCTCAC Chr16:17260407..17260427 59.17 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACATGGAGCTTCGTGACTG Chr16:17260466..17260486 59.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050240