Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24189
Trapped Gene
D3Ertd300e (ENSMUSG00000027751)
Vector Insertion
Chr 3: 54499130 - 54500405
Public Clones not available
Private Clones OST231793 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000511588 (Chr3:54499045..54499129 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACTTCCACAGCACGTCTA Chr3:54499070..54499089 59.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000511588 (Chr3:54499045..54499129 +)
Downstram Exon
ENSMUSE00000591824 (Chr3:54500406..54500441 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACTTCCACAGCACGTCTA Chr3:54499070..54499089 59.9 55 CGCAATCCAAAGCTTGTTCT Chr3:54500439..54500458 60.39 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000415967 Chr3:54497035..54497130 AGTGCGGTGTGACTGTTGAG Chr3:54497075..54497094 59.94 55
upstream ENSMUSE00000511588 Chr3:54499045..54499129 CCACTTCCACAGCACGTCTA Chr3:54499070..54499089 59.9 55

*** Putative Vector Insertion (Chr 3: 54499130 - 54500405) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000591824 Chr3:54500406..54500441 CGCAATCCAAAGCTTGTTCT Chr3:54500439..54500458 60.39 45
downstream ENSMUSE00000639266 Chr3:54500873..54500931 CTGAGCACTTTCCACGATGT Chr3:54500896..54500915 58.88 50
downstream ENSMUSE00000639265 Chr3:54502515..54502581 ACCTCGGGTTCTTTTTCACA Chr3:54502580..54502599 59.57 45
downstream ENSMUSE00000639264 Chr3:54505409..54505538 GCCTTCATTTCCTGGGTACA Chr3:54505507..54505526 59.93 50
downstream ENSMUSE00000639263 Chr3:54506993..54507096 TCATAAGGCAATCGGATGGT Chr3:54507023..54507042 60.3 45
downstream ENSMUSE00000639262 Chr3:54510782..54510898 TGCATTGTTGGACGTAAGAGA Chr3:54510899..54510919 59.33 42.86
downstream ENSMUSE00000639261 Chr3:54511010..54511063 TGGGTCCACTTATGGTTGTC Chr3:54511065..54511084 58.26 50
downstream ENSMUSE00000639260 Chr3:54512179..54512318 ATTGGGCGAGTGTTCATCTT Chr3:54512315..54512334 59.56 45
downstream ENSMUSE00000639259 Chr3:54512953..54513109 TTTCCTTTCCTTCCGCTTTT Chr3:54513070..54513089 60.18 40
downstream ENSMUSE00000639258 Chr3:54513195..54513251 AAGTTACAGGGGCTCCGTTT Chr3:54513232..54513251 60 50
downstream ENSMUSE00000639257 Chr3:54514323..54514394 TTGGCTGTGAGTCGTCAGAT Chr3:54514380..54514399 59.42 50
downstream ENSMUSE00000639256 Chr3:54516014..54516171 GATCCCCAAGAGACTGCAAG Chr3:54516104..54516123 59.8 55
downstream ENSMUSE00000639255 Chr3:54517098..54517124 No primer for this exon
downstream ENSMUSE00000639254 Chr3:54517655..54517687 GCGTCAGTCTTTGACCCAAT Chr3:54517684..54517703 60.12 50
downstream ENSMUSE00000639253 Chr3:54518610..54518718 GAGAGCGGCTGAACCACTAC Chr3:54518700..54518719 60.02 60
downstream ENSMUSE00000639251 Chr3:54519076..54519178 AGCCTGAGGGAAGTTTGATG Chr3:54519163..54519182 59.28 50
downstream ENSMUSE00000258573 Chr3:54519456..54519611 AAGGCTTGGCTTACACGATG Chr3:54519535..54519554 60.27 50
downstream ENSMUSE00000258568 Chr3:54520560..54521567 GAGAGCGAGCTTCCTGTTGT Chr3:54521513..54521532 59.75 55
downstream ENSMUSE00000415691 Chr3:54522156..54522313 GCTACGAGACCTCCTGATGG Chr3:54522275..54522294 59.83 60
downstream ENSMUSE00000415686 Chr3:54524328..54524383 No primer for this exon
downstream ENSMUSE00000415678 Chr3:54526443..54526562 TGTTGCTGCTGGGTGTTAAA Chr3:54526486..54526505 60.29 45
downstream ENSMUSE00000415671 Chr3:54529892..54529997 CTGCGCAGTTAACCCTTGTT Chr3:54529921..54529940 60.31 50
downstream ENSMUSE00000415668 Chr3:54531491..54531618 GGCTTTGCTCAGGTCTGTTC Chr3:54531538..54531557 60 55
downstream ENSMUSE00000415661 Chr3:54532266..54532684 ACGATGTAGCTGGGCTGTTT Chr3:54532337..54532356 59.76 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCACAATGGTAAGCTGTG Chr3:54499121..54499141 60.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCACAATGGTAAGCTGTG Chr3:54499121..54499141 60.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027751