Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24202
Trapped Gene
Nav1 (ENSMUSG00000009418)
Vector Insertion
Chr 1: 137433877 - 137481131
Public Clones CMHD-GT_430H9-3 (cmhd) IST14874C11 (tigm)
Private Clones OST231064 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000401133 (Chr1:137481132..137481932 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000401133 (Chr1:137481132..137481932 -)
Downstram Exon
ENSMUSE00000239228 (Chr1:137433774..137433876 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690480 Chr1:137584496..137584682 No primer for this exon
upstream ENSMUSE00000429775 Chr1:137503739..137503872 No primer for this exon
upstream ENSMUSE00000690479 Chr1:137503024..137504481 No primer for this exon
upstream ENSMUSE00000429766 Chr1:137499122..137499225 No primer for this exon
upstream ENSMUSE00000239238 Chr1:137481132..137482286 No primer for this exon
upstream ENSMUSE00000401133 Chr1:137481132..137481932 No primer for this exon

*** Putative Vector Insertion (Chr 1: 137433877 - 137481131) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000239228 Chr1:137433774..137433876 No primer for this exon
downstream ENSMUSE00000369434 Chr1:137428926..137429291 No primer for this exon
downstream ENSMUSE00000342073 Chr1:137369310..137369448 No primer for this exon
downstream ENSMUSE00000387979 Chr1:137368736..137369033 No primer for this exon
downstream ENSMUSE00000240534 Chr1:137367057..137367747 No primer for this exon
downstream ENSMUSE00000240525 Chr1:137366209..137366643 No primer for this exon
downstream ENSMUSE00000240517 Chr1:137365433..137365474 No primer for this exon
downstream ENSMUSE00000240583 Chr1:137364218..137364366 No primer for this exon
downstream ENSMUSE00000240578 Chr1:137362416..137362586 No primer for this exon
downstream ENSMUSE00000240653 Chr1:137361283..137361335 No primer for this exon
downstream ENSMUSE00000240572 Chr1:137360492..137360515 No primer for this exon
downstream ENSMUSE00000240644 Chr1:137360299..137360376 No primer for this exon
downstream ENSMUSE00000240632 Chr1:137357268..137357351 No primer for this exon
downstream ENSMUSE00000240623 Chr1:137356921..137357032 No primer for this exon
downstream ENSMUSE00000240618 Chr1:137355233..137355354 No primer for this exon
downstream ENSMUSE00000690482 Chr1:137354438..137354446 No primer for this exon
downstream ENSMUSE00000240613 Chr1:137351711..137351907 No primer for this exon
downstream ENSMUSE00000334951 Chr1:137351268..137351460 No primer for this exon
downstream ENSMUSE00000158909 Chr1:137351011..137351179 No primer for this exon
downstream ENSMUSE00000158910 Chr1:137350622..137350719 No primer for this exon
downstream ENSMUSE00000158916 Chr1:137349770..137349865 No primer for this exon
downstream ENSMUSE00000158920 Chr1:137349382..137349541 No primer for this exon
downstream ENSMUSE00000158907 Chr1:137348749..137348984 No primer for this exon
downstream ENSMUSE00000158908 Chr1:137347363..137347517 No primer for this exon
downstream ENSMUSE00000158906 Chr1:137347147..137347218 No primer for this exon
downstream ENSMUSE00000158913 Chr1:137346472..137346668 No primer for this exon
downstream ENSMUSE00000158918 Chr1:137345508..137345626 No primer for this exon
downstream ENSMUSE00000240675 Chr1:137340211..137340408 No primer for this exon
downstream ENSMUSE00000428972 Chr1:137338261..137338356 No primer for this exon
downstream ENSMUSE00000596238 Chr1:137335450..137338356 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr1:137442061..137442081 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATGACGTGACTGGGAAAACC Chr1:137439064..137439085 59.85 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCTCATTTGCTCTGGCTGA Chr1:137478894..137478914 59.67 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCTCATTTGCTCTGGCTGA Chr1:137478894..137478914 59.67 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009418