Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24221
Trapped Gene
Spc24 (ENSMUSG00000074476)
Vector Insertion
Chr 9: 21560740 - 21561560
Public Clones not available
Private Clones OST230600 (lexicon) OST38031 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000638257 (Chr9:21561561..21561637 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000638257 (Chr9:21561561..21561637 -)
Downstram Exon
ENSMUSE00000702626 (Chr9:21560547..21560739 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GTGCACTGTCCAAGTGGATG Chr9:21560670..21560689 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638264 Chr9:21564563..21564733 GGGAGCTACGAGCAGATGAT Chr9:21564610..21564629 59.42 55
upstream ENSMUSE00000638262 Chr9:21562129..21562273 AGACTCTGGCTGTGGAGGAG Chr9:21562254..21562273 59.58 60
upstream ENSMUSE00000638259 Chr9:21561734..21561838 CTCATCACAGAGCTGCAGGA Chr9:21561815..21561834 60.29 55
upstream ENSMUSE00000638257 Chr9:21561561..21561637 No primer for this exon

*** Putative Vector Insertion (Chr 9: 21560740 - 21561560) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702626 Chr9:21560547..21560739 GTGCACTGTCCAAGTGGATG Chr9:21560670..21560689 60.16 55
downstream ENSMUSE00000702627 Chr9:21560547..21560739 GTGCACTGTCCAAGTGGATG Chr9:21560670..21560689 60.16 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:21561490..21561510 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGATGATCAAGGGCAGTAT Chr9:21561555..21561575 58.81 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074476