Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2427
Trapped Gene
Pml (ENSMUSG00000036986)
Vector Insertion
Chr 9: 58069673 - 58077161
Public Clones AC0295 (sanger) PST23285-NR (escells) PST10188-NL (escells) PST23212-NR (escells)
PST24617-NR (escells) PST19333-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254833 (Chr9:58077162..58077214 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCGGACACCGAGAATCTG Chr9:58077162..58077181 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254833 (Chr9:58077162..58077214 -)
Downstram Exon
ENSMUSE00000254804 (Chr9:58069522..58069672 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCGGACACCGAGAATCTG Chr9:58077162..58077181 60.07 50 GCTGCTATCGTCCAACTCGT Chr9:58069624..58069643 60.43 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485399 Chr9:58097348..58097593 TGTCGACAACAGGACTCTGC Chr9:58097424..58097443 60.03 55
upstream ENSMUSE00000254921 Chr9:58094782..58095245 CAGTACGCGCAAGTCCAATA Chr9:58094825..58094844 59.9 50
upstream ENSMUSE00000254901 Chr9:58082160..58082740 GCCATCTCCATTGCGATATT Chr9:58082656..58082675 59.89 45
upstream ENSMUSE00000254882 Chr9:58080960..58081054 CACTCACCCAGTGACAACCA Chr9:58080983..58081002 60.63 55
upstream ENSMUSE00000457341 Chr9:58078298..58078435 AGACCCAACCTGTGGCTATG Chr9:58078370..58078389 59.99 55
upstream ENSMUSE00000254861 Chr9:58077635..58077893 CCACAGAGGAGAACGAGGAC Chr9:58077795..58077814 59.83 60
upstream ENSMUSE00000254833 Chr9:58077162..58077214 ATTCGGACACCGAGAATCTG Chr9:58077162..58077181 60.07 50

*** Putative Vector Insertion (Chr 9: 58069673 - 58077161) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254804 Chr9:58069522..58069672 GCTGCTATCGTCCAACTCGT Chr9:58069624..58069643 60.43 55
downstream ENSMUSE00000534036 Chr9:58066349..58068376 TCAGTGTGTGGAAACGGGTA Chr9:58067039..58067058 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGACCCTAGCCTGTTGAC Chr9:58071116..58071136 59.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGACCCTAGCCTGTTGAC Chr9:58071116..58071136 59.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCCTCTGCCATTAGTGCAT Chr9:58071163..58071183 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTCACGTGACTGGGAAAACC Chr9:58071148..58071168 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036986