Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24272
Trapped Gene
4732479N06Rik (ENSMUSG00000067369)
Vector Insertion
Chr X: 130801869 - 130802101
Public Clones not available
Private Clones OST226209 (lexicon) OST77786 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000546391 (ChrX:130801870..130802100 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGGGATACTGGAAGACCA ChrX:130802004..130802023 59.92 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000546391 (ChrX:130801870..130802100 -)
Downstram Exon
ENSMUSE00000716274 (ChrX:130801870..130802100 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGGGATACTGGAAGACCA ChrX:130802004..130802023 59.92 55 AAGCAGTCCTGGTTTGGAGA ChrX:130802003..130802022 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000546392 ChrX:130811385..130811479 TTAGTTTGCCACTGCACGTC ChrX:130811420..130811439 59.91 50
upstream ENSMUSE00000622607 ChrX:130811385..130811523 TTAGTTTGCCACTGCACGTC ChrX:130811420..130811439 59.91 50
upstream ENSMUSE00000694894 ChrX:130811385..130811459 TTAGTTTGCCACTGCACGTC ChrX:130811420..130811439 59.91 50
upstream ENSMUSE00000694893 ChrX:130805049..130805124 GTGGAGCATGTGTCCTTGTG ChrX:130805049..130805068 60.16 55
upstream ENSMUSE00000546391 ChrX:130801870..130802100 CCTGGGATACTGGAAGACCA ChrX:130802004..130802023 59.92 55
upstream ENSMUSE00000716274 ChrX:130801870..130802100 CCTGGGATACTGGAAGACCA ChrX:130802004..130802023 59.92 55

*** Putative Vector Insertion (Chr X: 130801869 - 130802101) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000546387 ChrX:130800800..130800854 AGCCTCCAGAGTGGAGTCAC ChrX:130800800..130800819 59.43 60
downstream ENSMUSE00000546384 ChrX:130798266..130798400 AGACTGATGTGCAGCCACTG ChrX:130798283..130798302 60.06 55
downstream ENSMUSE00000546380 ChrX:130797324..130797423 ACTTGTTCCGGTAGCCAGTG ChrX:130797374..130797393 60.17 55
downstream ENSMUSE00000546360 ChrX:130797027..130797423 ACTTGTTCCGGTAGCCAGTG ChrX:130797374..130797393 60.17 55
downstream ENSMUSE00000546376 ChrX:130796116..130796186 No primer for this exon
downstream ENSMUSE00000546375 ChrX:130777554..130777700 TACGAGTTCACGCCAGTGTC ChrX:130777598..130777617 59.9 55
downstream ENSMUSE00000546373 ChrX:130775516..130775610 TCAATTCACAGATCGCTCCA ChrX:130775516..130775535 60.35 45
downstream ENSMUSE00000546371 ChrX:130774894..130775108 TGCCACAGCAAATGTCTAGG ChrX:130774875..130774894 59.86 50
downstream ENSMUSE00000546368 ChrX:130774618..130774719 ACTGCCTGCTCCACTAGCTC ChrX:130774628..130774647 59.78 60
downstream ENSMUSE00000546366 ChrX:130773006..130773125 GGCAAAATCGTCTCTGCTCT ChrX:130773055..130773074 59.58 50
downstream ENSMUSE00000546365 ChrX:130772682..130772781 GGCTCGCACCACTCTGTAAT ChrX:130772740..130772759 60.28 55
downstream ENSMUSE00000641227 ChrX:130757639..130759244 CTATGGCAACCTGGGTGTCT ChrX:130759038..130759057 59.99 55
downstream ENSMUSE00000546363 ChrX:130757494..130759244 CTATGGCAACCTGGGTGTCT ChrX:130759038..130759057 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGGCCTGTCTCTTTGATTG ChrX:130802103..130802123 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGGCCTGTCTCTTTGATTG ChrX:130802103..130802123 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067369