Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24278
Trapped Gene
Irf1 (ENSMUSG00000018899)
Vector Insertion
Chr 11: 53586441 - 53587157
Public Clones not available
Private Clones OST226026 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000103551 (Chr11:53586341..53586440 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000103551 (Chr11:53586341..53586440 +)
Downstram Exon
ENSMUSE00000103555 (Chr11:53587158..53587334 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678519 Chr11:53583553..53583780 No primer for this exon
upstream ENSMUSE00000367120 Chr11:53583580..53583780 No primer for this exon
upstream ENSMUSE00000653602 Chr11:53583997..53584193 No primer for this exon
upstream ENSMUSE00000103557 Chr11:53584786..53584877 No primer for this exon
upstream ENSMUSE00000719906 Chr11:53584786..53584877 No primer for this exon
upstream ENSMUSE00000103551 Chr11:53586341..53586440 No primer for this exon

*** Putative Vector Insertion (Chr 11: 53586441 - 53587157) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000103555 Chr11:53587158..53587334 No primer for this exon
downstream ENSMUSE00000103547 Chr11:53587428..53587477 No primer for this exon
downstream ENSMUSE00000103553 Chr11:53587564..53587696 No primer for this exon
downstream ENSMUSE00000103549 Chr11:53587848..53587970 No primer for this exon
downstream ENSMUSE00000103548 Chr11:53588556..53588605 No primer for this exon
downstream ENSMUSE00000103554 Chr11:53589420..53589555 No primer for this exon
downstream ENSMUSE00000103552 Chr11:53589815..53590825 No primer for this exon
downstream ENSMUSE00000706072 Chr11:53589815..53590823 No primer for this exon
downstream ENSMUSE00000678516 Chr11:53590874..53591876 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACAAGGATGCCTGTCTGT Chr11:53586398..53586418 58.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACAAGGATGCCTGTCTGT Chr11:53586398..53586418 58.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018899