Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24285
Trapped Gene
Ppp4c (ENSMUSG00000030697)
Vector Insertion
Chr 7: 133931125 - 133931630
Public Clones not available
Private Clones OST225908 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000202105 (Chr7:133931631..133931732 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGGACCGTGGTTTCTACA Chr7:133931666..133931685 60 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000202105 (Chr7:133931631..133931732 -)
Downstram Exon
ENSMUSE00000202086 (Chr7:133930951..133931124 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGGACCGTGGTTTCTACA Chr7:133931666..133931685 60 50 TGGGTAATCTGGCGACTCTC Chr7:133931041..133931060 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000472118 Chr7:133935937..133935985 GGAAGTGGGGAGTCGAAGAG Chr7:133935960..133935979 61.16 60
upstream ENSMUSE00000202083 Chr7:133935575..133935737 CTGCGAGCTGATCAAAGAGA Chr7:133935606..133935625 59.42 50
upstream ENSMUSE00000202102 Chr7:133932538..133932589 AGAAGAGAGCAACGTGCAGAG Chr7:133932557..133932577 59.94 52.38
upstream ENSMUSE00000202096 Chr7:133931898..133931948 GGTGACATCCATGGACAATTC Chr7:133931922..133931942 60.05 47.62
upstream ENSMUSE00000202105 Chr7:133931631..133931732 TGTGGACCGTGGTTTCTACA Chr7:133931666..133931685 60 50

*** Putative Vector Insertion (Chr 7: 133931125 - 133931630) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000202086 Chr7:133930951..133931124 TGGGTAATCTGGCGACTCTC Chr7:133931041..133931060 60.22 55
downstream ENSMUSE00000202091 Chr7:133930734..133930860 TCATGGGGTACCTCTTGCTT Chr7:133930750..133930769 59.55 50
downstream ENSMUSE00000202099 Chr7:133929886..133930075 GCAGTAATTAGGCGCTGACC Chr7:133929869..133929888 59.87 55
downstream ENSMUSE00000408203 Chr7:133929421..133929805 TGGATCAAGTGGGAGAAAGG Chr7:133929486..133929505 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000030697