Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24316
Trapped Gene
Tmem93 (ENSMUSG00000047260)
Vector Insertion
Chr 11: 72990254 - 72990357
Public Clones not available
Private Clones OST224906 (lexicon) OST214658 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676911 (Chr11:72990358..72990504 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCGCTTTTTCCTGTCTGA Chr11:72990476..72990495 60.51 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676911 (Chr11:72990358..72990504 -)
Downstram Exon
ENSMUSE00000392452 (Chr11:72989699..72990253 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCGCTTTTTCCTGTCTGA Chr11:72990476..72990495 60.51 50 CTTCCCGCTTTGAGAATGAG Chr11:72989969..72989988 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000351274 Chr11:72990441..72990539 CTCCGCTTTTTCCTGTCTGA Chr11:72990476..72990495 60.51 50
upstream ENSMUSE00000676911 Chr11:72990358..72990504 CTCCGCTTTTTCCTGTCTGA Chr11:72990476..72990495 60.51 50

*** Putative Vector Insertion (Chr 11: 72990254 - 72990357) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676910 Chr11:72989838..72990253 CTTCCCGCTTTGAGAATGAG Chr11:72989969..72989988 59.95 50
downstream ENSMUSE00000392452 Chr11:72989699..72990253 CTTCCCGCTTTGAGAATGAG Chr11:72989969..72989988 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:72990286..72990306 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000047260